Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPL5P37
Plot displaying the genomic locations of a retrocopy (in chr2) and its respective parental gene (in chr1). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr2:238735261-238735510  UCSC
Coordinates (T2T) chr2:239225475-239225724  UCSC
Coordinates (hg19) chr2:239643902-239644151  UCSC
Strand -
Parental Sequence NM_000969.5
Parental seq. overlap 213 bp
Parental seq. overlap (%) 20.7%
Genomic Region Intergenic
Retrocopy Summary RPL5P37, located on chr2:238735261-238735510, is a retrocopy of the parental gene RPL5. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL5
Full Name ribosomal protein L5
Also known as L5|MSTP030|PPP1R135|uL18
Coordinate chr1:92832040-92841924
Strand +
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of four RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L18P family of ribosomal proteins and component of the 60S subunit. The encoded protein binds 5S rRNA to form a stable complex called the 5S ribonucleoprotein particle (RNP), which is necessary for the transport of nonribosome-associated cytoplasmic 5S rRNA to the nucleolus for assembly into ribosomes. The encoded protein may also function to inhibit tumorigenesis through the activation of downstream tumor suppressors and the downregulation of oncoprotein expression. Mutations in this gene have been identified in patients with Diamond-Blackfan Anemia (DBA). This gene is co-transcribed with the small nucleolar RNA gene U21, which is located in its fifth intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. [provided by RefSeq, Mar 2017]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPL5P7
Bonobo Pan paniscus RPL5P7
Gorilla Gorilla gorilla RPL5P7
Orangutan Pongo abelii RPL5P6
Gibbon Nomascus leucogenys RPL5P36
Mouse lemur Microcebus murinus RPL5P5
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPL5P37
AAGAAGATCAAGATGCTTACAAGAAACAATCCTTTCAATACATCAAGAACAACATTAACTCCAGACACAACAGCAGAGATGTATAAGAAAACTCACGCTGCTATATGACAAAATACAGTCTAAGAGAAGCCCAAAAAAGAAGTTAAAAGAAGAGGTGGAACCGTTCCACAATATCCCTTGCCCAGAAGAAAAAGCAGATAGCTTAAAAGAAGGCAACCTTCTTCAGAGCCCAGGAGCGGACTGCTGAGAT
>NM_000969.5
CCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTTCCGCAGGATGGGGTTTGTTAAAGTTGTTAAGAATAAGGCCTACTTTAAGAGATACCAAGTGAAATTTAGAAGACGACGAGAGGGTAAAACTGATTATTATGCTCGGAAACGCTTGGTGATACAAGATAAAAATAAATACAACACACCCAAATACAGGATGATAGTTCGTGTGACAAACAGAGATATCATTTGTCAGATTGCTTATGCCCGTATAGAGGGGGATATGATAGTCTGCGCAGCGTATGCACACGAACTGCCAAAATATGGTGTGAAGGTTGGCCTGACAAATTATGCTGCAGCATATTGTACTGGCCTGCTGCTGGCCCGCAGGCTTCTCAATAGGTTTGGCATGGACAAGATCTATGAAGGCCAAGTGGAGGTGACTGGTGATGAATACAATGTGGAAAGCATTGATGGTCAGCCAGGTGCCTTCACCTGCTATTTGGATGCAGGCCTTGCCAGAACTACCACTGGCAATAAAGTTTTTGGTGCCCTGAAGGGAGCTGTGGATGGAGGCTTGTCTATCCCTCACAGTACCAAACGATTCCCTGGTTATGATTCTGAAAGCAAGGAATTTAATGCAGAAGTACATCGGAAGCACATCATGGGCCAGAATGTTGCAGATTACATGCGCTACTTAATGGAAGAAGATGAAGATGCTTACAAGAAACAGTTCTCTCAATACATAAAGAACAGCGTAACTCCAGACATGATGGAGGAGATGTATAAGAAAGCTCATGCTGCTATACGAGAGAATCCAGTCTATGAAAAGAAGCCCAAGAAAGAAGTTAAAAAGAAGAGGTGGAACCGTCCCAAAATGTCCCTTGCTCAGAAGAAGGATCGGGTAGCTCAAAAGAAGGCAAGCTTCCTCAGAGCTCAGGAGCGGGCTGCTGAGAGCTAAACCCAGCAATTTTCTATGATTTTTTCAGATATAGATAATAAACTTATGAACAGCAACTA

Publications

PMID - Link Title