| Retrocopy Name | RPL5P37 |
|
| Species | Homo sapiens | |
| Coordinates (hg38) | chr2:238735261-238735510 UCSC | |
| Coordinates (T2T) | chr2:239225475-239225724 UCSC | |
| Coordinates (hg19) | chr2:239643902-239644151 UCSC | |
| Strand | - | |
| Parental Sequence | NM_000969.5 | |
| Parental seq. overlap | 213 bp | |
| Parental seq. overlap (%) | 20.7% | |
| Genomic Region |
Intergenic |
|
| Retrocopy Summary | RPL5P37, located on chr2:238735261-238735510, is a retrocopy of the parental gene RPL5. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | RPL5 |
| Full Name | ribosomal protein L5 |
| Also known as | L5|MSTP030|PPP1R135|uL18 |
| Coordinate | chr1:92832040-92841924 |
| Strand | + |
| Gene summary | Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of four RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L18P family of ribosomal proteins and component of the 60S subunit. The encoded protein binds 5S rRNA to form a stable complex called the 5S ribonucleoprotein particle (RNP), which is necessary for the transport of nonribosome-associated cytoplasmic 5S rRNA to the nucleolus for assembly into ribosomes. The encoded protein may also function to inhibit tumorigenesis through the activation of downstream tumor suppressors and the downregulation of oncoprotein expression. Mutations in this gene have been identified in patients with Diamond-Blackfan Anemia (DBA). This gene is co-transcribed with the small nucleolar RNA gene U21, which is located in its fifth intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. [provided by RefSeq, Mar 2017] |
| Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | RPL5P7 |
![]() |
Bonobo | Pan paniscus | RPL5P7 |
![]() |
Gorilla | Gorilla gorilla | RPL5P7 |
![]() |
Orangutan | Pongo abelii | RPL5P6 |
![]() |
Gibbon | Nomascus leucogenys | RPL5P36 |
![]() |
Mouse lemur | Microcebus murinus | RPL5P5 |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >RPL5P37 |
| AAGAAGATCAAGATGCTTACAAGAAACAATCCTTTCAATACATCAAGAACAACATTAACTCCAGACACAACAGCAGAGATGTATAAGAAAACTCACGCTGCTATATGACAAAATACAGTCTAAGAGAAGCCCAAAAAAGAAGTTAAAAGAAGAGGTGGAACCGTTCCACAATATCCCTTGCCCAGAAGAAAAAGCAGATAGCTTAAAAGAAGGCAACCTTCTTCAGAGCCCAGGAGCGGACTGCTGAGAT |
| >NM_000969.5 |
| CCTTTTCCCACCCCCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTTCCGCAGGATGGGGTTTGTTAAAGTTGTTAAGAATAAGGCCTACTTTAAGAGATACCAAGTGAAATTTAGAAGACGACGAGAGGGTAAAACTGATTATTATGCTCGGAAACGCTTGGTGATACAAGATAAAAATAAATACAACACACCCAAATACAGGATGATAGTTCGTGTGACAAACAGAGATATCATTTGTCAGATTGCTTATGCCCGTATAGAGGGGGATATGATAGTCTGCGCAGCGTATGCACACGAACTGCCAAAATATGGTGTGAAGGTTGGCCTGACAAATTATGCTGCAGCATATTGTACTGGCCTGCTGCTGGCCCGCAGGCTTCTCAATAGGTTTGGCATGGACAAGATCTATGAAGGCCAAGTGGAGGTGACTGGTGATGAATACAATGTGGAAAGCATTGATGGTCAGCCAGGTGCCTTCACCTGCTATTTGGATGCAGGCCTTGCCAGAACTACCACTGGCAATAAAGTTTTTGGTGCCCTGAAGGGAGCTGTGGATGGAGGCTTGTCTATCCCTCACAGTACCAAACGATTCCCTGGTTATGATTCTGAAAGCAAGGAATTTAATGCAGAAGTACATCGGAAGCACATCATGGGCCAGAATGTTGCAGATTACATGCGCTACTTAATGGAAGAAGATGAAGATGCTTACAAGAAACAGTTCTCTCAATACATAAAGAACAGCGTAACTCCAGACATGATGGAGGAGATGTATAAGAAAGCTCATGCTGCTATACGAGAGAATCCAGTCTATGAAAAGAAGCCCAAGAAAGAAGTTAAAAAGAAGAGGTGGAACCGTCCCAAAATGTCCCTTGCTCAGAAGAAGGATCGGGTAGCTCAAAAGAAGGCAAGCTTCCTCAGAGCTCAGGAGCGGGCTGCTGAGAGCTAAACCCAGCAATTTTCTATGATTTTTTCAGATATAGATAATAAACTTATGAACAGCAACTA |
| PMID - Link | Title |
|---|