Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name DNPH1P1
Plot displaying the genomic locations of a retrocopy (in chr22) and its respective parental gene (in chr6). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr22:42132634-42133108  UCSC
Coordinates (T2T) chr22:42612130-42612604  UCSC
Coordinates (hg19) chr22:42528641-42529115  UCSC
Strand +
Parental Sequence NM_006443.3
Parental seq. overlap 399 bp
Parental seq. overlap (%) 60.8%
Genomic Region Intergenic
Retrocopy Summary DNPH1P1, located on chr22:42132634-42133108, is a retrocopy of the parental gene DNPH1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name DNPH1
Full Name 2'-deoxynucleoside 5'-phosphate N-hydrolase 1
Also known as C6orf108|RCL|dJ330M21.3
Coordinate chr6:43225629-43229481
Strand -
Gene summary This gene was identified on the basis of its stimulation by c-Myc protein. The latter is a transcription factor that participates in the regulation of cell proliferation, differentiation, and apoptosis. The exact function of this gene is not known but studies in rat suggest a role in cellular proliferation and c-Myc-mediated transformation. Two alternative transcripts encoding different proteins have been described. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes DNPH1P1
Bonobo Pan paniscus DNPH1P1
Gorilla Gorilla gorilla DNPH1P1
Orangutan Pongo abelii DNPH1P1
Gibbon Nomascus leucogenys DNPH1P1
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>DNPH1P1
CCAGTGCTCACCGAGCACGTGGCGGCTGTGGAGCTGGACGCGGGGTTGATAAGTCCGCTGGGGGTGACGGGCTCATCCATGAGTGGTACTTGATGTGGCTGCAGAAGGCGGATGTGGTGGTGGCAGAAGTGACACAACTGTCCCTGGGTATAGGCTATGATCTGTGCCAGGCCACAGCCCTCAATAAGTGAATCCTGTGCCTGCTCCAGCCGCAGTCTGGTGGAGTGCTGTCGGCCATGATCTGGGAAGAGGCAGATGGCTCTGGGTTCCAGGTGTGGGACTACGGAGAGGGACAGGTGGAGGCCCTGCTGCATGGATAGGTTGAGGCTGATCCTCCCGAGCAGGTTGCCTCCCCTAACCCAACCATTGGACCTAATCCCATTTTATTAAATTCTTCTCATCCCAGACACTGCTCTAGTACCAGTCCTGGCTCTTTGCCCCAGGAGCAAATTAAAAGGTACATTTAAAATTCTAA
>NM_006443.3
GCCGGAGAGCGCGGGCGGCTGGGGAATGGCTGCTGCCATGGTGCCGGGGCGCAGCGAGAGCTGGGAGCGCGGGGAGCCTGGCCGCCCGGCCCTGTACTTCTGCGGGAGCATTCGCGGCGGACGCGAGGACAGGACGCTGTACGAGCGGATCGTGTCTCGGCTGCGGCGATTCGGGACAGTGCTCACCGAGCACGTGGCGGCCGCCGAGCTGGGCGCGCGCGGGGAAGAGGCTGCTGGGGGTGACAGGCTCATCCATGAGCAGGACCTGGAGTGGCTGCAGCAGGCGGACGTGGTCGTGGCAGAAGTGACACAGCCATCCTTGGGTGTAGGCTATGAGCTGGGCCGGGCCGTGGCCTTTAACAAGCGGATCCTGTGCCTGTTCCGCCCGCAGTCTGGCCGCGTGCTTTCGGCCATGATCCGGGGAGCAGCAGATGGCTCTCGGTTCCAGGTGTGGGACTATGAGGAGGGAGAGGTGGAGGCCCTGCTGGATCGATACTTCGAGGCTGATCCTCCAGGGCAGGTGGCTGCCTCCCCTGACCCAACCACTTGACTTAATCTCACTTTCTTAAATTCTTCTATTCTCAGACACTGCTCTAGTACCATTCCTTCCTCTTAGCCCCAGGAGCAAATTAAAAGGTACAGTTAAAATCCTAA

Publications

PMID - Link Title