| Retrocopy Name | TMEM230P3 |
|
| Species | Homo sapiens | |
| Coordinates (hg38) | chr2:50829440-50829775 UCSC | |
| Coordinates (T2T) | chr2:50825601-50825936 UCSC | |
| Coordinates (hg19) | chr2:51056578-51056913 UCSC | |
| Strand | - | |
| Parental Sequence | NM_001330987.2 | |
| Parental seq. overlap | 331 bp | |
| Parental seq. overlap (%) | 24.9% | |
| Genomic Region |
Intragenic (NRXN1) |
|
| Retrocopy Summary | TMEM230P3, located on chr2:50829440-50829775, is a retrocopy of the parental gene TMEM230. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | TMEM230 |
| Full Name | transmembrane protein 230 |
| Also known as | C20orf30|HSPC274|dJ1116H23.2.1 |
| Coordinate | chr20:5068375-5113091 |
| Strand | - |
| Gene summary | This gene encodes a multi-pass transmembrane protein that belongs to the TMEM134/TMEM230 protein family. The encoded protein localizes to secretory and recycling vesicle in the neuron and may be involved in synaptic vesicles trafficking and recycling. Mutations in this gene may be linked to familial Parkinson's disease. [provided by RefSeq, Mar 2017] |
| Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | Without Homology |
![]() |
Bonobo | Pan paniscus | Without Homology |
![]() |
Gorilla | Gorilla gorilla | Without Homology |
![]() |
Orangutan | Pongo abelii | Without Homology |
![]() |
Gibbon | Nomascus leucogenys | Without Homology |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >TMEM230P3 |
| GGCTGAGTGGCACTTAAGCGGGCCATGCCGTGCAACCTTGGGCGCTGCCAACCGTGGGCGAGCTCTGGGTGTGCGGGCGGCCTGGCGCGGCGCTCCGCTGTGTCAGCCTGTTATGATGCCGTCCCGTACCAACCTGGCTACTGGAATCCCCAGTAGTAAAGTGAAATATTCAAGGCTCTCCAGCACAGACGATGGCTACATGGACCTTCAGTTTAAGAAAACCCCTCCTAAGATCCCTTATAAGGCCATCGCACTTGCCACTGTGCTGTTTTTGATTCGCGCCTTTCTCATTATTATAGGCTCCCTCCTGCTGTCAGGCTACATCAGCAAAGGGAA |
| >NM_001330987.2 |
| ACTGATCCCGCCTGGGGCCGGCTGAGTGGCACTTAAGCGGGCCATGCCATGCAACCTTGGGCGCTGCCAACCGTGGGCGAGCTCTGGGTGTGCGGGCGGCCTGGCGCGGCGCTCCGCTGTGTCAGCGTGTTATGATGCCGTCCCGTACCAACCTGGCTACTGGAATCCCCAGTAGTAAAGTGAAATATTCAAGGCTCTCCAGCACAGACGATGGCTACATTGACCTTCAGTTTAAGAAAACCCCTCCTAAGATCCCTTATAAGGCCATCGCACTTGCCACTGTGCTGTTTTTGATTGGCGCCTTTCTCATTATTATAGGCTCCCTCCTGCTGTCAGGCTACATCAGCAAAGGGAGTCTCGAATCCACCTCACGGGAACAAAAGAAAGCTGACCACAAACATCTACCAGCATCCCGTGGGTACATGATGGGAGGCATCAGTGGGAGGAGTCCCGAAGGAGGACTCAGCTCAAGGCTTCCAGAAGGAAGAGGAACACAGGTGTCATCACCTGACTGAGGTTGGTGCCTCTAATTTGAGATAAGCATCTTAAAAGGGCTAAACTGAAAATGTCCTAGGAATAAGTACGTCAGCATGAAAATGACTGATTGTAAAATGCAGCAGAGAGCTTCTCCTACTAAGAGCAGGATATGTGGAGGGAATGTTCCATATGCCTAGAGGAGCAGGCCAAAGGAATTCCAGCTGCCCTCTACCCCCTATGCAACTCCTCTTGTGAATGGTGAGAATGGCGCAGACCACTCCCCATGGCCCCACCTCTGTTCCTGAGGGTAGGAGGATTCCTGTCCCCTTCATACCATCCTTGGTACTGAGAGCGATGCTGAAGAGACTGGGATGCTCATATTCTCACAAAGGGACTGCAGGgtggtacagatggctggatgcccagtactacatccattctcccctttttctttagtaatagaaccactgaaccttagctggatgagtaataaaaccgctggataatcttggcctaacatggtgatatgatttggctctgtgtccccacccgaatctcactttgaattgtaatccctgtaattcccatgtatcaaaggaggtactaggtggaggtaattggatcatggggtggtttcccccaagctgttcttgtgatagtgagtgactctcatgagatctgatggttttataagcatctggcatttcccctgcttgcactcactctgtcctggtgcgctgtgaagaaggtgcctgcttctcctttgccttccaccatgattgtaagtttcctgaggcctccctggcaatgcagaactgtgagtcaattaaacttcttttctttataaatta |
| PMID - Link | Title |
|---|