Summary

Retrocopy Name	PAGE4P1
Species	Homo sapiens
Coordinates (hg38)	chr3:4784924-4785073  UCSC
Coordinates (T2T)	chr3:4778773-4778922  UCSC
Coordinates (hg19)	chr3:4826608-4826757  UCSC
Strand	+
Parental Sequence	NM_001318877.1
Parental seq. overlap	129 bp
Parental seq. overlap (%)	16.6%
Genomic Region	Intragenic (ITPR1)
Retrocopy Summary	PAGE4P1, located on chr3:4784924-4785073, is a retrocopy of the parental gene PAGE4. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name	PAGE4
Full Name	PAGE family member 4
Also known as	CT16.7|GAGE-9|GAGEC1|JM-27|JM27|PAGE-1|PAGE-4
Coordinate	chrX:49829260-49834264
Strand	+
Gene summary	This gene is a member of the GAGE family. The GAGE genes are expressed in a variety of tumors and in some fetal and reproductive tissues. This gene is strongly expressed in prostate and prostate cancer. It is also expressed in other male and female reproductive tissues including testis, fallopian tube, uterus, and placenta, as well as in testicular cancer and uterine cancer. The protein encoded by this gene shares sequence similarity with other GAGE/PAGE proteins, and also belongs to a family of CT (cancer-testis) antigens. The protein may play a role in benign and malignant prostate diseases. A related pseudogene is located on chromosome 7. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]

Homology

	Species	Scientific Name	Retrocopy
	Chimpanzee	Pan troglodytes	PAGE4P1
	Bonobo	Pan paniscus	PAGE4P1
	Orangutan	Pongo abelii	PAGE4P1
	Baboon	Papio anubis	PAGE4P1
	Gorilla	Gorilla gorilla	Without Homology
	Gibbon	Nomascus leucogenys	Without Homology
	Green monkey	Chlorocebus sabaeus	Without Homology
	Crab-eating macaque	Macaca fascicularis	Without Homology
	Rhesus	Macaca mulatta	Without Homology
	Golden snub-nosed monkey	Rhinopithecus roxellana	Without Homology
	Marmoset	Callithrix jacchus	Without Homology
	Mouse lemur	Microcebus murinus	Without Homology
	Mouse	Mus musculus	Without Homology
	Rat	Rattus norvegicus	Without Homology
	Chinese hamster	Cricetulus griseus	Without Homology
	Rabbit	Oryctolagus cuniculus	Without Homology
	Pig	Sus scrofa	Without Homology
	Cow	Bos taurus	Without Homology
	Sheep	Ovis aries	Without Homology
	Dolphin	Tursiops truncatus	Without Homology
	Horse	Equus caballus	Without Homology
	Dog	Canis familiaris	Without Homology
	Panda	Ailuropoda melanoleuca	Without Homology
	Cat	Felis catus	Without Homology
	Pale spear-nosed bat	Phyllostomus discolor	Without Homology
	Velvety free-tailed bat	Molossus molossus	Without Homology
	Greater mouse-eared bat	Myotis myotis	Without Homology
	Kuhl's pipistrelle	Pipistrellus kuhlii	Without Homology
	Greater horseshoe bat	Rhinolophus ferrumequinum	Without Homology
	Egyptian rousette	Rousettus aegyptiacus	Without Homology
	Sloth	Choloepus didactylus	Without Homology
	Tasmanian Devil	Sarcophilus harrisii	Without Homology
	Opossum	Monodelphis domestica	Without Homology
	Platypus	Ornithorhynchus anatinus	Without Homology
	Chicken	Gallus gallus	Without Homology
	Turkey	Meleagris gallopavo	Without Homology
	Zebra Finch	Taeniopygia guttata	Without Homology
	Budgerigar	Melopsittacus undulatus	Without Homology
	Painted Turtle	Chrysemys picta	Without Homology
	Lizard	Anolis Carolinensis	Without Homology
	Frog	Xenopus tropicalis	Without Homology
	Zebrafish	Danio rerio	Without Homology
	Drosophila	Drosophila melanogaster	Without Homology

Expression

This retrocopy transcript is not present in the GTEx database for expression quantification.

This retrocopy transcript is not present in the ARCHS4 database for expression quantification

Related Sequence

>PAGE4P1

TGTGAGTGTGGAGATGGCCATAATGTGAAAGGGGAGACTCCACCTAATCTAGGGAATGCTCAAATTACAGAAGCAGGTGCTGGGCAGCCATAAGTTAAAAAGAAGACAAGCTGAAGCCACACATGTTGGTGTTATATTGAAAATGTGACT

>NM_001318877.1

TGACACTGCTGAGGTCTAAACAAGGAGGCAGAAGTAGTCTTCAGTTCACGATCTTCTAGTTGCAGCGATGAGTGCACGAGTGAGATCAAGATCCAGAGGAAGAGGAGATGGTCAGGAGGCTCCCGATGTGGTTGCATTCGTGGCTCCCGGTGAATCTCAGCAAGAGGAACCACCAACTGACAATCAGGATATTGAACCTGGACAAGAGAGAGAAGGAACACCTCCGATCGAAGAACGTAAAGTAGAAGGTGATTGCCAGGAAATGGATCTGGAAAAGACTCGGAGTGAGCGTGGAGATGGCTCTGATGTAAAAGAGAAGACTCCACCTAATCCTAAGCATGCTAAGACTAAAGAAGCAGGAGATGGGCAGCCATAAGTTAAAAAGAAGACAAGCTGAAGCTACACACATGGCTGATGTCACATTGAAAATGTGACTGAAAATTTGAaaattctctcaataaagtttgagttttctctgaagaagtcatgcgtgtcttttgtaaaatttattcctaggaaattgacactattgtaaatggtatctttaaaaaatccttgtgttctgtttagagctggtatatatttttgtatactgattttgtgttgggcaacattgctaaacttgcctattctgttggtttatccctacgtccttttggattttctccatacacaatcataccacatgtaaataatgataattctgttttttccttttgaggctttgtactttcatttctggtccttatgacactggccagacccctccagtacaatg

Publications

PMID - Link	Title
No publications available for this retrocopy