Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name UBL5P3
Plot displaying the genomic locations of a retrocopy (in chr3) and its respective parental gene (in chr19). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr3:63203120-63203364  UCSC
Coordinates (T2T) chr3:63246706-63246950  UCSC
Coordinates (hg19) chr3:63188796-63189040  UCSC
Strand -
Parental Sequence NM_024292.4
Parental seq. overlap 202 bp
Parental seq. overlap (%) 40.6%
Genomic Region Intragenic (SYNPR)
Retrocopy Summary UBL5P3, located on chr3:63203120-63203364, is a retrocopy of the parental gene UBL5. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name UBL5
Full Name ubiquitin like 5
Also known as HUB1
Coordinate chr19:9827918-9830115
Strand +
Gene summary This gene encodes a member of a group of proteins similar to ubiquitin. The encoded protein is not thought to degrade proteins like ubiquitin but to affect their function through being bound to target proteins by an isopeptide bond. The gene product has been studied as a link to predisposition to obesity based on its expression in Psammomys obesus, the fat sand rat, which is an animal model for obesity studies. Variation in this gene was found to be significantly associated with some metabolic traits (PMID: 15331561) but not associated with childhood obesity (PMID: 19189687). Pseudogenes of this gene are located on chromosomes 3, 5 and 17. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2013]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes UBL5P1
Bonobo Pan paniscus UBL5P1
Gorilla Gorilla gorilla UBL5P2
Gibbon Nomascus leucogenys UBL5P2
Green monkey Chlorocebus sabaeus UBL5P3
Crab-eating macaque Macaca fascicularis UBL5P1
Rhesus Macaca mulatta UBL5P1
Baboon Papio anubis UBL5P1
Golden snub-nosed monkey Rhinopithecus roxellana LOC115892812P1
Marmoset Callithrix jacchus UBL5P1
Orangutan Pongo abelii Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>UBL5P3
GACCGTAAGAAGCTGATTGCAGCCCAAGCTGTCACCCATTGTAAAAAGATTATCCTGAAGAAATGGTACATGATTTTTAGGGACCACACGATACTGGGGGACCATGAAATCCATGATGGGATGGACCTGGAGCTTTATTTTCAATAGATTAGAATCCTAATATTTCTGCTGCCCCACTGTCCTCTCTCATCCTCACATCCTCACCCCCAACACTGGTATAGATGCTTGTTTTTAAAAACTCACCC
>NM_024292.4
AACTGCGACCGGGGTTCAGCGCTCGGGTGAGGAGCTGGTGGCGTCGGCAGGTTCGAGGCGATTCGAGGTGAGGGGGTCAAGCGGAGAGGCTCGGAGTCGGAGAAAGCTGTCGCGACCCAGCCACCCAGGGTCTGGGGTCGGTGGGAGCTCCAGCTAGGATGATCGAGGTTGTTTGCAACGACCGTCTGGGGAAGAAGGTCCGCGTTAAATGCAACACGGATGATACCATCGGGGACCTTAAGAAGCTGATTGCAGCCCAAACTGGTACCCGTTGGAACAAGATTGTCCTGAAGAAGTGGTACACGATTTTTAAGGACCACGTGTCTCTGGGGGACTATGAAATCCACGATGGGATGAACCTGGAGCTTTATTATCAATAGATGAGAATCCTCATCTTCCTGCCCCGCTTTCCTCTCCCATCCTCATCCCCCACACTGGGATAGATGCTTGTTTGTAAAAACTCACCTTAATAAAGACTTAGATGTTG

Publications

PMID - Link Title