Retrocopy Name | PRDX5P2 |
![]() |
Species | Homo sapiens | |
Coordinates (hg38) | chr3:73648409-73648676 UCSC | |
Coordinates (T2T) | chr3:73689901-73690168 UCSC | |
Coordinates (hg19) | chr3:73697560-73697827 UCSC | |
Strand | - | |
Parental Sequence | NM_001358516.2 | |
Parental seq. overlap | 237 bp | |
Parental seq. overlap (%) | 34.1% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | PRDX5P2, located on chr3:73648409-73648676, is a retrocopy of the parental gene PRDX5. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | PRDX5 |
Full Name | peroxiredoxin 5 |
Also known as | ACR1|AOEB166|B166|HEL-S-55|PLP|PMP20|PRDX6|PRXV|SBBI10|prx-V |
Coordinate | chr11:64318121-64321811 |
Strand | + |
Gene summary | This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein interacts with peroxisome receptor 1 and plays an antioxidant protective role in different tissues under normal conditions and during inflammatory processes. The use of alternate transcription start sites is thought to result in transcript variants that use different in-frame translational start codons to generate isoforms that are targeted to the mitochondrion (isoform L) or peroxisome/cytoplasm (isoform S). Multiple related pseudogenes have been defined for this gene. [provided by RefSeq, Nov 2017] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | PRDX5P2 |
![]() |
Bonobo | Pan paniscus | PRDX5P2 |
![]() |
Gorilla | Gorilla gorilla | PRDX5P2 |
![]() |
Orangutan | Pongo abelii | PRDX5P2 |
![]() |
Gibbon | Nomascus leucogenys | PRDX5P1 |
![]() |
Green monkey | Chlorocebus sabaeus | PRDX5P2 |
![]() |
Crab-eating macaque | Macaca fascicularis | PRDX5P1 |
![]() |
Rhesus | Macaca mulatta | PRDX5P1 |
![]() |
Baboon | Papio anubis | PRDX5P1 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | PRDX5P1 |
![]() |
Marmoset | Callithrix jacchus | LOC100388856P1 |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>PRDX5P2 |
AGGGAACACAGTGAACCTGGCAGAGCTGTTCAAGGGCAAGAAGGGTGTTCTGTTTGGAGTTCCTCAAGCCTTTAGCCCCAGCTGTTCCAAACACCTGCCAGGGTTGGTGGAGCAGGCTGGGGCTTTGAGGGCCAAGGGGGTCCCAGCGGTGGCATGTCTGAGTGTTAACGATGCCTTTGTGACTGGCAAGTAGGGATGAGCCCACAAGGTTAAAGGCAAGGTTCGGCTCCTGGCTGACCCCACTGGGGCCTTTGGGAAGGAGGCAGAT |
>NM_001358516.2 |
AGTCTGCGGCAGCGGCAGCAAGACGGTACAGTGAAGGAGAGTGGGCGTCTGGCGGGGTCCGCAGTTTCAGCAGAGCCGCTGCAGCCATGGCCCCAATCAAGGTGGGAGATGCCATCCCAGCAGTGGAGGTGTTTGAAGGGGAGCCAGGGAACAAGGTGAACCTGGCAGAGCTGTTCAAGGGCAAGAAGGGTGTGCTGTTTGGAGTTCCTGGGGCCTTCACCCCTGGATGTTCCAAGACACACCTGCCAGGGTTTGTGGAGCAGGCTGAGGCTCTGAAGGCCAAGGGAGTCCAGGTGGTGGCCTGTCTGAGTGTTAATGATGCCTTTGTGACTGGCGAGTGGGGCCGAGCCCACAAGGCGGAAGGCAAGGTTCGGCTCCTGGCTGATCCCACTGGGGCCTTTGGGAAGGAGACAGACTTATTACTAGATGATTCGCTGGTGTCCATCTTTGGGAATCGACGTCTCAAGAGGTTCTCCATGGTGGTacaggatggcatagtgaaggccctgaatgtggaaccagatggcacaggcctcacctgcagcctggcacccaatatcatctcacagctctgaggccctgggccagattacttcctccacccctccctatctcaCCTGCCCAGCCCTGTGCTGGGGCCCTGCAATTGGAATGTTGGCCAGATTTCTGCAATAAACACTTGTGGTTTGCGGCCA |
PMID - Link | Title |
---|---|
No publications available for this retrocopy |