Retrocopy Name | SERF1AP1 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr4:137300805-137301268 UCSC | |
Coordinates (T2T) | chr4:140623750-140624213 UCSC | |
Coordinates (hg19) | chr4:138221959-138222422 UCSC | |
Strand | - | |
Parental Sequence | NM_022968.2_3 | |
Parental seq. overlap | 415 bp | |
Parental seq. overlap (%) | 59.2% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | SERF1AP1, located on chr4:137300805-137301268, is a retrocopy of the parental gene SERF1A. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | SERF1A |
Full Name | small EDRK-rich factor 1A |
Also known as | 4F5|FAM2A|H4F5|SERF1|SMAM1 |
Coordinate | chr5:70900669-70918530 |
Strand | + |
Gene summary | This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. The duplication region includes both a telomeric and a centromeric copy of this gene. Deletions of this gene, the telomeric copy, often accompany deletions of the neighboring SMN1 gene in spinal muscular atrophy (SMA) patients, and so it is thought that this gene may be a modifier of the SMA phenotype. The function of this protein is not known; however, it bears low-level homology with the RNA-binding domain of matrin-cyclophilin, a protein which colocalizes with small nuclear ribonucleoproteins (snRNPs) and the SMN1 gene product. Alternatively spliced transcripts have been documented but it is unclear whether alternative splicing occurs for both the centromeric and telomeric copies of the gene. [provided by RefSeq, Jul 2008] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | LOC741943P1 |
![]() |
Bonobo | Pan paniscus | SERF1AP1 |
![]() |
Gorilla | Gorilla gorilla | SERF1AP1 |
![]() |
Orangutan | Pongo abelii | SERF1AP1 |
![]() |
Gibbon | Nomascus leucogenys | SERF1AP2 |
![]() |
Green monkey | Chlorocebus sabaeus | SERF1AP2 |
![]() |
Rhesus | Macaca mulatta | SERF1AP1 |
![]() |
Baboon | Papio anubis | SERF1AP1 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | SERF1AP1 |
![]() |
Marmoset | Callithrix jacchus | SERF1AP1 |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>SERF1AP1 |
CGGTGGTGATGGTAGCCTAGTGTGCCAGGGAGCTGTTGCTTTTTCTGAGTCGCTTTATTCCAGGCTCTGTCAATGGTCGGCATGGCCCGTGGAAATCAATGAGAACTTGTCCACCAGAAAAAACATGGAGAAAACCCAGGAAAATAGTAAGGGGAAAAGAAAAGAGGATAGGTTGACTACCTCTCAGAGAAAGCATAGGGACTCTGAGCTCATGCAACAAAAGCAGAAGGCAGCTAATGAGAAGTCTATGCAGACAAAAGAAAAATAATGACTGGCTATTTGGAAAACATGGGTGCTACTGCCAACTGGGTGTGTCATAAGCTTTAAGGTCAAGATTCTGTAGAGTGAATAGTCATTACATATACTATGACTTATACTTTAAAAACTATTTTAAACTTTACCTTTCAGCTTGACTTAGTGTGATGTTTTAGAAGCATTCTTCAAAGAATAAAGCACTAACCATA |
>NM_022968.2_3 |
AGTGACGCGCCGGCCATGCCGGCGGCTGTTGTCGGGCCTCCAGCGGGCGGGGCCGTTGGCGGAGCAGAGGGGAGGCGCAGCCGGGCGGAGGGCCCACGAGGGCTCAGCCTTCCCGGTCAGCGGTGGTGACGGTATCCCAGAGTGCCAGAGAACCGTTGCTTTTCCGAGTTGCTCTTCTTCCAGGCTCCGTTGGTGGTCGGCATGGCCCGTGGAAATCAACGAGAACTTGCCCGCCAGAAAAACATGAAGAAAACCCAGGAAATTAGCAAGGGAAAGAGGAAAGAGGATAGCTTGACTGCCTCTCAGAGAAAGCAGAGGGACTCTGAGATCATGCAAGAAAAGCAGAAGGCAGCTAATGAGAAGAAGTCTATGCAGACAAGAGAAAAGTGATGACTGGCTATTTGGAAAACCTGGGTGCTACTGCCAACTGGGTGTATCATAAGCTCTAAGATCAAGATTTTGTAGAGTGGACAGTCATTACATATGTTATAACTTATCCTTTAAAAACTATTTTAAACTTTATCCTTTCAGCTTTACTTAGTGCGATGTTTTAGAAGCAGTCTTCAAAGAATAAAACACTAACCATGCATGTGACATATTGGTGAACATTATTTTTATTATTGAACATTCATATATAATTTATTAGGTAATATGATCAGATAATAGGATCTCTTATATAATAAAGAATCTTTGTCATCA |
PMID - Link | Title |
---|