| Retrocopy Name | KHDC3LP1 |
|
| Species | Homo sapiens | |
| Coordinates (hg38) | chr4:162985015-162985171 UCSC | |
| Coordinates (T2T) | chr4:166332811-166332967 UCSC | |
| Coordinates (hg19) | chr4:163906167-163906323 UCSC | |
| Strand | + | |
| Parental Sequence | NM_001017361.3 | |
| Parental seq. overlap | 137 bp | |
| Parental seq. overlap (%) | 13.2% | |
| Genomic Region |
Intergenic |
|
| Retrocopy Summary | KHDC3LP1, located on chr4:162985015-162985171, is a retrocopy of the parental gene KHDC3L. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | KHDC3L |
| Full Name | KH domain containing 3 like, subcortical maternal complex member |
| Also known as | C6orf221|ECAT1|HYDM2 |
| Coordinate | chr6:73362658-73364171 |
| Strand | + |
| Gene summary | The protein encoded by this gene belongs to the KHDC1 family, members of which contain an atypical KH domain that may not bind RNA like canonical KH domains. This gene is specifically expressed in the oocytes, and recent studies suggest that it may function as a regulator of genomic imprinting in the oocyte. Mutations in this gene are associated with recurrent biparental complete hydatidiform mole. [provided by RefSeq, Dec 2011] |
| Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | KHDC3LP1 |
![]() |
Bonobo | Pan paniscus | KHDC3LP1 |
![]() |
Gorilla | Gorilla gorilla | KHDC3LP1 |
![]() |
Orangutan | Pongo abelii | KHDC3LP1 |
![]() |
Gibbon | Nomascus leucogenys | KHDC3LP1 |
![]() |
Green monkey | Chlorocebus sabaeus | KHDC3LP2 |
![]() |
Crab-eating macaque | Macaca fascicularis | KHDC3LP1 |
![]() |
Rhesus | Macaca mulatta | KHDC3LP1 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | KHDC3LP1 |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >KHDC3LP1 |
| AGCGAGGCTGAGATCTTGATATTTGGGAGGCCTTATTGCCAGAAGGACACATTCAAGATGATCATGAATACTTGATTGACTATCACGACCAGCTCCAGGTGCAAGCCTCGGAAAAGGCCCTCGCCCAGGATGTCGACACTCAGAAGGCTGAGACCCA |
| >NM_001017361.3 |
| CTAGTCTCCCAGCTCCAGCTCGGCCTTTGGGTTTGCTGTGGTGTCCTTGTCTCCTGCAGGACCGGCCGCAGCATGGACGCTCCCAGGCGGTTTCCGACGCTCGTGCAACTGATGCAGCCAAAAGCAATGCCAGTGGAGGTGCTCGGTCACCTCCCTAAGCGGTTCTCCTGGTTCCACTCTGAGTTCCTGAAGAATCCGAAGGTAGTTCGCCTTGAGGTTTGGCTGGTGGAAAAGATCTTCGGCCGGGGCGGAGAACGCATCCCGCACGTCCAGGGTATGTCCCAAATCTTGATTCACGTGAATCGATTGGACCCTAACGGCGAGGCTGAGATCTTGGTATTTGGGAGGCCTTCTTACCAGGAGGACACAATCAAGATGATCATGAACCTGGCTGACTATCACCGCCAGCTCCAGGCGAAAGGCTCAGGAAAGGCCCTCGCCCAGGATGTCGCCACTCAGAAGGCCGAGACCCAGCGGTCTTCAATAGAAGTCCGGGAGGCCGGGACGCAGCGTTCGGTGGAGGTCCGGGAGGCCGGGACCCAGCGTTCGGTGGAAGTCCAGGAGGTCGGGACACAGGGTTCTCCGGTGGAGGTGCAGGAGGCCGGGACCCAGCAGTCTCTCCAGGCTGCCAACAAGTCGGGGACCCAGCGATCCCCCGAAGCTGCCAGCAAGGCAGTGACCCAGCGGTTTCGCGAGGATGCCCGGGACCCAGTTACTAGATTATGAAGGCATCTCAGGCCCTGGAGCCAGAGCCAGTCAGGGGTTAAAGTGAAAGCCCGTATTTCCGCCCAGAAGCTGGGGTTGGGGAGAGGATGTGGATTTTTTGTTTTACCCTTTCTGTTGCATGGTTGCAAACACAAACTTGAGTTCTAATAAAGAATTGCAAAGTGGAAGCCCGCCCCCCGCCTCCCCCCCGCCTCACTTAAGTCCAGGAAGCTGGGGTGGCGAGGAAGGATGATGTGGATTGTTTTTGTTTTACACCTTCTGTTGAATGGTTGCCAACACAAACTTGAGTTCTAATAAATAATTGCATTTCC |
| PMID - Link | Title |
|---|