Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name RPL38P7
Plot displaying the genomic locations of a retrocopy (in chr4) and its respective parental gene (in chr17). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr4:173435806-173436004  UCSC
Coordinates (T2T) chr4:176775386-176775584  UCSC
Coordinates (hg19) chr4:174356957-174357155  UCSC
Strand +
Parental Sequence NM_001035258.2
Parental seq. overlap 174 bp
Parental seq. overlap (%) 15.7%
Genomic Region Intragenic (SCRG1)
Retrocopy Summary RPL38P7, located on chr4:173435806-173436004, is a retrocopy of the parental gene RPL38. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL38
Full Name ribosomal protein L38
Also known as L38
Coordinate chr17:74203678-74210655
Strand +
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L38E family of ribosomal proteins. It is located in the cytoplasm. Alternative splice variants have been identified, both encoding the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome, including one located in the promoter region of the type 1 angiotensin II receptor gene. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPL38P6
Bonobo Pan paniscus RPL38P5
Gorilla Gorilla gorilla RPL38P6
Orangutan Pongo abelii RPL38P5
Gibbon Nomascus leucogenys LOC100605420P3
Green monkey Chlorocebus sabaeus RPL38P1
Crab-eating macaque Macaca fascicularis RPL38P4
Rhesus Macaca mulatta RPL38P4
Baboon Papio anubis RPL38P3
Golden snub-nosed monkey Rhinopithecus roxellana RPL38P3
Horse Equus caballus RPL38P1
Dog Canis familiaris RPL38P14
Panda Ailuropoda melanoleuca RPL38P6
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPL38P7
TGTCGCCATGCCTCTCAAAATTAAGAAAATCAAGGACTTTCTGCTCACAGACAAAAGGATGCCAAATAACTCAGGATCAAGAAATATAAGAATAATGTGAATTTACAAGTTCAGTGCAACAGATACCTTTATAACTTGGTCATCACAAAGAGAAGGCAGAGAAACTGAAGCAGCCCCTGCCCCCAGTTTTGGCAGTGAA
>NM_001035258.2
CTTTTTCGTCCTTTTCCCCGGTTGCTGCTTGCTGTCCTGGTCCGCGCCAGAGCCCAGCGCGCCTCGTCGCCATGCCTCGGAAAATTGAGGAAATCAAGGACTTCCTGCTCACAGCCCGACGAAAGGATGCCAAATCTGTCAAGATCAAGAAAAATAAGGACAACGTGAAGTTTAAAGTTCGATGCAGCAGATACCTTTACACCCTGGTCATCACTGACAAAGAGAAGGCAGAGAAACTGAAGCAGTCCCTGCCCCCCGGTTTGGCAGTGAAGGAACTGAAATGAACCAGACACACTGATTGGAACTGTATTATATTAAAATACTAAAAATCCTAAGTGTCTTTCGTCTTTGCGGATGGGAAAGGGAAAAATGCTACCTCGTAGTGGCTTCTGATGGGAACAGGACGCGGGTTCTGTTGCTGCCTTCCTGTGTCTTTTTTTttttttttttttctttctttgagacggagtcttgctctgtggctcatcctggagcacagtggtgcgatatcagctcactaccacctccgcctcctgggttcaagcgactgtcctgcctcagcctcccgagtggctgggattacaggcacacatcaccacgcctggccaatttttgtatttgtagtagagacagggtttcactgcctgcctcagcctcccatagtgctgggattacaggcatgagcctccgtgcccggTGCATCCCTAATCTTGAGCATGATCTCAGTCGGCAAATGAGGCCATCTGTTTTCAGCCTGTTTGAAAATAAGATGTGGGGAGGCCATGATGGAAATAGCACGTGGGGTTAAACATAACTGGCAGATGTGGGAGCGATGGTGGGGCATGCCATTCAAACAGGTCCCAAAATGGGTGCAACAAGGTATAGCACAtctaccactcgctaacttgactgacttggagaaatgactacacttttgcctgtttcctcagttggaaaatagccatattaacacctctttcattggcttgctgtcagggtactgggatGGGGGGAGGTGCATGGGTTGGGGTGGCCACCAGGTGGTGCTGTGCCACAGCGGGCAGCCCCTCTGGAAATGACTGGCATCATAAAATCTGTCTTCATACCCGA

Publications

PMID - Link Title