Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name FAUP3
Plot displaying the genomic locations of a retrocopy (in chr4) and its respective parental gene (in chr11). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr4:188106537-188106724  UCSC
Coordinates (T2T) chr4:191454221-191454408  UCSC
Coordinates (hg19) chr4:189027691-189027878  UCSC
Strand +
Parental Sequence NM_001997.5
Parental seq. overlap 160 bp
Parental seq. overlap (%) 31.6%
Genomic Region Intragenic (TRIML2)
Retrocopy Summary FAUP3, located on chr4:188106537-188106724, is a retrocopy of the parental gene FAU. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name FAU
Full Name FAU ubiquitin like and ribosomal protein S30 fusion
Also known as FAU1|Fub1|Fubi|MNSFbeta|RPS30|S30|asr1
Coordinate chr11:65120630-65122134
Strand -
Gene summary This gene is the cellular homolog of the fox sequence in the Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV). It encodes a fusion protein consisting of the ubiquitin-like protein fubi at the N terminus and ribosomal protein S30 at the C terminus. It has been proposed that the fusion protein is post-translationally processed to generate free fubi and free ribosomal protein S30. Fubi is a member of the ubiquitin family, and ribosomal protein S30 belongs to the S30E family of ribosomal proteins. Whereas the function of fubi is currently unknown, ribosomal protein S30 is a component of the 40S subunit of the cytoplasmic ribosome and displays antimicrobial activity. Pseudogenes derived from this gene are present in the genome. Similar to ribosomal protein S30, ribosomal proteins S27a and L40 are synthesized as fusion proteins with ubiquitin. [provided by RefSeq, Nov 2014]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes FAUP2
Bonobo Pan paniscus FAUP2
Gorilla Gorilla gorilla FAUP2
Orangutan Pongo abelii FAUP2
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>FAUP3
AACCGCGGTTCAGTCACCAACATGCAGTTCTTGGTCCGCGCCCCGGAGCTACACGCCCTCCAGGTGACCGGCCAGGAGACGGTCTCCCAGGTCGCGGCTCAGGCAGCGCCACTGGAGGGCTTCGCCCCGGAAGATCTATCGTGCTCCTGGCAGGCGCGTCCCTGCAGGGCGAGGCCACCCTGGACCAG
>NM_001997.5
CTCTTTCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGTTCAGTCGCCAATATGCAGCTCTTTGTCCGCGCCCAGGAGCTACACACCTTCGAGGTGACCGGCCAGGAAACGGTCGCCCAGATCAAGGCTCATGTAGCCTCACTGGAGGGCATTGCCCCGGAAGATCAAGTCGTGCTCCTGGCAGGCGCGCCCCTGGAGGATGAGGCCACTCTGGGCCAGTGCGGGGTGGAGGCCCTGACTACCCTGGAAGTAGCAGGCCGCATGCTTGGAGGTAAAGTCCATGGTTCCCTGGCCCGTGCTGGAAAAGTGAGAGGTCAGACTCCTAAGGTGGCCAAACaggagaagaagaagaagaagaCAGGTCGGGCTAAGCGGCGGATGCAGTACAACCGGCGCTTTGTCAACGTTGTGCCCACCTTTGGCAAGAAGAAGGGCCCCAATGCCAACTCTTAAGTCTTTTGTAATTCTGGCTTTCTCTAATAAAAAAGCCACTTAGTTCAGTCA

Publications

PMID - Link Title