Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name RPS27P38
Plot displaying the genomic locations of a retrocopy (in chr5) and its respective parental gene (in chr1). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr5:126540770-126540931  UCSC
Coordinates (T2T) chr5:127057638-127057799  UCSC
Coordinates (hg19) chr5:125876462-125876623  UCSC
Strand +
Parental Sequence NM_001030.6
Parental seq. overlap 145 bp
Parental seq. overlap (%) 41.2%
Genomic Region Intergenic
Retrocopy Summary RPS27P38, located on chr5:126540770-126540931, is a retrocopy of the parental gene RPS27. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPS27
Full Name ribosomal protein S27
Also known as DBA17|MPS-1|MPS1|S27
Coordinate chr1:153990762-153992155
Strand +
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of four RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the S27e family of ribosomal proteins and component of the 40S subunit. The encoded protein contains a C4-type zinc finger domain that can bind to zinc and may bind to nucleic acid. Mutations in this gene have been identified in numerous melanoma patients and in at least one patient with Diamond-Blackfan anemia (DBA). Elevated expression of this gene has been observed in various human cancers. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2018]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPS27P12
Bonobo Pan paniscus RPS27P11
Gorilla Gorilla gorilla RPS27P11
Orangutan Pongo abelii RPS27P12
Gibbon Nomascus leucogenys RPS27P1
Green monkey Chlorocebus sabaeus RPS27P25
Crab-eating macaque Macaca fascicularis RPS27P15
Rhesus Macaca mulatta RPS27P14
Baboon Papio anubis RPS27P14
Golden snub-nosed monkey Rhinopithecus roxellana RPS27P6
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPS27P38
ACCAATTCCTTCTTCATGGATGTGAAATGACCAGGATGCTATCAAGTCACCATGCTCTTTCGTCATGCCCAAAGTTGTGTGTGTTGGCTGTTCCACTGTCCTATCAGCCTACAGAAGGACAAGCAAAGCTTACAGAAGAATGTTCCTTAGGAGGAAGCAGCA
>NM_001030.6
CCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTCATCCCTCTCCAGAAGAGGAGAAGAGGAAACACAAGAAGAAACGCCTGGTGCAGAGCCCCAATTCCTACTTCATGGATGTGAAATGCCCAGGATGCTATAAAATCACCACGGTCTTTAGCCATGCACAAACGGTAGTTTTGTGTGTTGGCTGCTCCACTGTCCTCTGCCAGCCTACAGGAGGAAAAGCAAGGCTTACAGAAGGATGTTCCTTCAGGAGGAAGCAGCACTAAAAGCACTCTGAGTCAAGATGAGTGGGAAACCATCTCAATAAACACATTTTGGATAAATCCTG

Publications

PMID - Link Title