| Retrocopy Name | NACAP6 |
|
| Species | Homo sapiens | |
| Coordinates (hg38) | chr5:16192290-16192445 UCSC | |
| Coordinates (T2T) | chr5:16131613-16131769 UCSC | |
| Coordinates (hg19) | chr5:16192399-16192554 UCSC | |
| Strand | - | |
| Parental Sequence | NM_001320194.2 | |
| Parental seq. overlap | 134 bp | |
| Parental seq. overlap (%) | 13% | |
| Genomic Region |
Intergenic |
|
| Retrocopy Summary | NACAP6, located on chr5:16192290-16192445, is a retrocopy of the parental gene NACA. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | NACA |
| Full Name | nascent polypeptide associated complex subunit alpha |
| Also known as | HSD48|NAC-alpha|NACA1|skNAC |
| Coordinate | chr12:56712427-56725299 |
| Strand | - |
| Gene summary | This gene encodes a protein that associates with basic transcription factor 3 (BTF3) to form the nascent polypeptide-associated complex (NAC). This complex binds to nascent proteins that lack a signal peptide motif as they emerge from the ribosome, blocking interaction with the signal recognition particle (SRP) and preventing mistranslocation to the endoplasmic reticulum. This protein is an IgE autoantigen in atopic dermatitis patients. Alternative splicing results in multiple transcript variants, but the full length nature of some of these variants, including those encoding very large proteins, has not been determined. There are multiple pseudogenes of this gene on different chromosomes. [provided by RefSeq, Feb 2016] |
| Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | NACAP3 |
![]() |
Bonobo | Pan paniscus | NACAP3 |
![]() |
Gorilla | Gorilla gorilla | NACAP9 |
![]() |
Green monkey | Chlorocebus sabaeus | LOC103238540P1 |
![]() |
Crab-eating macaque | Macaca fascicularis | NACAP4 |
![]() |
Rhesus | Macaca mulatta | NACAP4 |
![]() |
Baboon | Papio anubis | LOC101018001P3 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | NACAP2 |
![]() |
Orangutan | Pongo abelii | Without Homology |
![]() |
Gibbon | Nomascus leucogenys | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >NACAP6 |
| GGAAACCTAAAAATACCCTCTTTGTCATCCCAAGGCCAGATGTCTACAAGAGCCCAGCTTCAGATACCTCTACATTTTGGGGAAGCCAAGAGCAAAGATACATCTCAGCAAGTACAGCTACCAGATGCTGAGAAATTCAAAGGTCAGGGTGAAGCC |
| >NM_001320194.2 |
| CTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGAAACCGTCCCTGCTACAGAGCAGGAGTTGCCGCAGCCCCAGGCTGAGACAGGGTCTGGAACAGAATCTGACAGTGATGAATCAGTACCAGAGCTTGAAGAACAGGATTCCACCCAGGCAACCACACAACAAGCCCAGCTGGCGGCAGCAGCTGAAATTGATGAAGAACCAGTCAGTAAAGCAAAACAGAGTCGGAGTGAAAAGAAGGCACGGAAGGCTATGTCCAAACTGGGTCTTCGGCAGGTTACAGGAGTTACTAGAGTCACTATCCGGAAATCTAAGAATATCCTCTTTGTCATCACAAAACCAGATGTCTACAAGAGCCCTGCTTCAGATACTTACATAGTTTTTGGGGAAGCCAAGATCGAAGATTTATCCCAGCAAGCACAACTAGCAGCTGCTGAGAAATTCAAAGTTCAAGGTGAAGCTGTCTCAAACATTCAAGAAAACACACAGACTCCAACTGTACAAGAGGAGAGTGAAGAGGAAGAGGTCGATGAAACAGGTGTAGAAGTTAAGGACATTGAATTGGTCATGTCACAAGCAAATGTGTCGAGAGCAAAGGCAGTCCGAGCCCTGAAGAACAACAGTAATGATATTGTAAATGCGATTATGGTAAGTGTTCAAGCCTTTGTTCCTTGACTCCCTCTGCCCTGACCAATTATGAGTGACTTTATTTTGTCTTGCTAAATATCAGCCAATTAAGGAACCTCATTCCAGAGCCTCTTCTGAGTTGCCGTATAGGTTTTAGTGGCCTAAATTCTCCTGATTTGCCTGTAAGAGTTTTAGTGACCTGAATTCTCCTGATTTGCCTATAAGAACCGCTAATTATCTTTTCTCTGTTACAGGAATTAACAATGTAACCATATGGAAGCAACTTTTTTTGGTGTCTCAAAGGAGTAACTGCAGCTTGGTTTGAAATTTGTACTGTTTCTATCATAAATAAAGTTATGGCTTCTTGTTGGATGAATTCA |
| PMID - Link | Title |
|---|