Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name PIGPP6
Wait
Plot displaying the genomic locations of a retrocopy (in chr5) and its respective parental gene (in chr21). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr5:172784014-172784297  UCSC
Coordinates (T2T) chr5:173324133-173324416  UCSC
Coordinates (hg19) chr5:172211017-172211300  UCSC
Strand -
Parental Sequence NM_153681.2
Parental seq. overlap 231 bp
Parental seq. overlap (%) 25.4%
Genomic Region Intergenic
Retrocopy Summary PIGPP6, located on chr5:172784014-172784297, is a retrocopy of the parental gene PIGP. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name PIGP
Full Name phosphatidylinositol glycan anchor biosynthesis class P
Also known as DCRC|DCRC-S|DEE55|DSCR5|DSRC|EIEE55|PIG-P
Coordinate chr21:37065364-37073071
Strand -
Gene summary This gene encodes an enzyme involved in the first step of glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells that serves to anchor proteins to the cell surface. The encoded protein is a component of the GPI-N-acetylglucosaminyltransferase complex that catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI). This gene is located in the Down Syndrome critical region on chromosome 21 and is a candidate for the pathogenesis of Down syndrome. This gene has multiple pseudogenes and is a member of the phosphatidylinositol glycan anchor biosynthesis gene family. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2016]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes PIGPP2
Gorilla Gorilla gorilla PIGPP3
Orangutan Pongo abelii PIGPP2
Gibbon Nomascus leucogenys PIGPP1
Green monkey Chlorocebus sabaeus PIGPP4
Crab-eating macaque Macaca fascicularis PIGPP2
Baboon Papio anubis PIGPP2
Bonobo Pan paniscus Without Homology
Rhesus Macaca mulatta Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

This retrocopy transcript is not present in the ARCHS4 database for expression quantificationThis retrocopy transcript is not present in the GTEx database for expression quantification.

Related Sequence

>PIGPP6
CTCTTATTTGGAATTAACACAATGGATACCCCTCCACTCAATTCCATTCATACAGTCACAGATAACTAGGCCAAAAACCAACAACAGAAGGAATACCAAAAGAGGTCACCCAAGCATTAAGAGATACTCCCCATAGTGAAGTAAAACTAGCATCCTTTCTTGCAGCCAAAACACTTTATGCCAAATACTGAATTGTGTGTAGACATACTAATACGAAGCATTTGTTTTTAAGTTTTTGGCATAATTTTGACCATAATTATTTTGACTATTTTTTTTATTAATAC
>NM_153681.2
GGAGGCCACGCTTGCAGAGCTGGAGCGCGCGTCTATCGCCCCAGAACCCCCCTCCCTGCCCTATCCTCCGCCACCCCTTCTGTTGCGGGGCGCGCGCCAGCCTGGGTGTCTGTATGCGCTCGAGGCGGGGGCGCGGGTTGCGGACGGAGGCGCGGGAGGCGGTTCTGCGCGGCGGGGGCCGTACCCGCGGCGGAGCGAGGAGGCGAGAATGGATCAATGGTGCCACGGAGCACATCGCTGACGCTGATTGTGTTCCTTTTCCACAGATTGTCTAAAGCCCCAGGAAAAATGGTGGAAAATTCACCGTCGCCATTGCCAGAAAGAGCGATTTATGGCTTTGTTCTTTTCTTAAGCTCCCAATTTGGCTTCATACTTTACCTCGTGTGGGCCTTTATTCCTGAATCTTGGCTAAACTCTTTAGGTTTAACCTATTGGCCTCAAAAATATTGGGCAGTTGCATTACCTGTCTACCTCCTTATTGCTATAGTAATTGGCTACGTGCTCTTGTTTGGGATTAACATGATGAGTACCTCTCCACTCGACTCCATCCATACAATCACAGATAACTATGCAAAAAATCAACAGCAGAAGAAATACCAAGAGGAGGCCATTCCAGCCTTAAGAGATATTTCTATTAGTGAAGTAAACCAAATGTTCTTTCTTGCAGCCAAAGAACTTTACACCAAAAACTGAACTGTGTGTAACCATAGTAACACCAAGCACGTATTTATTTATAAGTTTTTGCCATTATAATTTTGACCATAAATTAATTTGACCATCTCTCTTATTAATAGAGAAGTAAAAAATGTAAGTTGACCTTCTCTTAGATTATGTTCAATGAATATTGTAAATGTTCAAGTATTGTTAATGAATAGAATAAATACAATATTGCATTCCCATATAGCAGACTT

Publications

PMID - Link Title
No publications available for this retrocopy