Retrocopy Name | UBL5P1 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr5:29600657-29600857 UCSC | |
Coordinates (T2T) | chr5:29714797-29714997 UCSC | |
Coordinates (hg19) | chr5:29600764-29600964 UCSC | |
Strand | + | |
Parental Sequence | NM_001048241.3 | |
Parental seq. overlap | 175 bp | |
Parental seq. overlap (%) | 42.9% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | UBL5P1, located on chr5:29600657-29600857, is a retrocopy of the parental gene UBL5. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | UBL5 |
Full Name | ubiquitin like 5 |
Also known as | HUB1 |
Coordinate | chr19:9827918-9830115 |
Strand | + |
Gene summary | This gene encodes a member of a group of proteins similar to ubiquitin. The encoded protein is not thought to degrade proteins like ubiquitin but to affect their function through being bound to target proteins by an isopeptide bond. The gene product has been studied as a link to predisposition to obesity based on its expression in Psammomys obesus, the fat sand rat, which is an animal model for obesity studies. Variation in this gene was found to be significantly associated with some metabolic traits (PMID: 15331561) but not associated with childhood obesity (PMID: 19189687). Pseudogenes of this gene are located on chromosomes 3, 5 and 17. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2013] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | UBL5P2 |
![]() |
Bonobo | Pan paniscus | UBL5P2 |
![]() |
Gorilla | Gorilla gorilla | UBL5P4 |
![]() |
Orangutan | Pongo abelii | UBL5P1 |
![]() |
Green monkey | Chlorocebus sabaeus | UBL5P1 |
![]() |
Crab-eating macaque | Macaca fascicularis | UBL5P2 |
![]() |
Rhesus | Macaca mulatta | UBL5P2 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | LOC115892812P2 |
![]() |
Gibbon | Nomascus leucogenys | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>UBL5P1 |
TGATTCCAGCTCCAGCCACGATGACCAAGATTGTTTGCACGACTTTCTGGGGAAGAAGGTCCGCATTAAATGCAACACGGATGACACCATCGGGGACCCTAAGAAGCTGATTGCGTCCCAAACTGGCACCCTGCTGGACAAGAGTGTCCTGAACAAGTACACTATTTTTAACAATCACATGTCCTTGGGGGACTATGAAAT |
>NM_001048241.3 |
AACTGCGACCGGGGTTCAGCGCTCGGGTGAGGAGCTGGTGGCGTCGGCAGGTTCGAGGCGATTCGAGCTCCAGCTAGGATGATCGAGGTTGTTTGCAACGACCGTCTGGGGAAGAAGGTCCGCGTTAAATGCAACACGGATGATACCATCGGGGACCTTAAGAAGCTGATTGCAGCCCAAACTGGTACCCGTTGGAACAAGATTGTCCTGAAGAAGTGGTACACGATTTTTAAGGACCACGTGTCTCTGGGGGACTATGAAATCCACGATGGGATGAACCTGGAGCTTTATTATCAATAGATGAGAATCCTCATCTTCCTGCCCCGCTTTCCTCTCCCATCCTCATCCCCCACACTGGGATAGATGCTTGTTTGTAAAAACTCACCTTAATAAAGACTTAGATGTTG |
PMID - Link | Title |
---|