Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name UBL5P1
Plot displaying the genomic locations of a retrocopy (in chr5) and its respective parental gene (in chr19). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr5:29600657-29600857  UCSC
Coordinates (T2T) chr5:29714797-29714997  UCSC
Coordinates (hg19) chr5:29600764-29600964  UCSC
Strand +
Parental Sequence NM_001048241.3
Parental seq. overlap 175 bp
Parental seq. overlap (%) 42.9%
Genomic Region Intergenic
Retrocopy Summary UBL5P1, located on chr5:29600657-29600857, is a retrocopy of the parental gene UBL5. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name UBL5
Full Name ubiquitin like 5
Also known as HUB1
Coordinate chr19:9827918-9830115
Strand +
Gene summary This gene encodes a member of a group of proteins similar to ubiquitin. The encoded protein is not thought to degrade proteins like ubiquitin but to affect their function through being bound to target proteins by an isopeptide bond. The gene product has been studied as a link to predisposition to obesity based on its expression in Psammomys obesus, the fat sand rat, which is an animal model for obesity studies. Variation in this gene was found to be significantly associated with some metabolic traits (PMID: 15331561) but not associated with childhood obesity (PMID: 19189687). Pseudogenes of this gene are located on chromosomes 3, 5 and 17. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2013]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes UBL5P2
Bonobo Pan paniscus UBL5P2
Gorilla Gorilla gorilla UBL5P4
Orangutan Pongo abelii UBL5P1
Green monkey Chlorocebus sabaeus UBL5P1
Crab-eating macaque Macaca fascicularis UBL5P2
Rhesus Macaca mulatta UBL5P2
Golden snub-nosed monkey Rhinopithecus roxellana LOC115892812P2
Gibbon Nomascus leucogenys Without Homology
Baboon Papio anubis Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>UBL5P1
TGATTCCAGCTCCAGCCACGATGACCAAGATTGTTTGCACGACTTTCTGGGGAAGAAGGTCCGCATTAAATGCAACACGGATGACACCATCGGGGACCCTAAGAAGCTGATTGCGTCCCAAACTGGCACCCTGCTGGACAAGAGTGTCCTGAACAAGTACACTATTTTTAACAATCACATGTCCTTGGGGGACTATGAAAT
>NM_001048241.3
AACTGCGACCGGGGTTCAGCGCTCGGGTGAGGAGCTGGTGGCGTCGGCAGGTTCGAGGCGATTCGAGCTCCAGCTAGGATGATCGAGGTTGTTTGCAACGACCGTCTGGGGAAGAAGGTCCGCGTTAAATGCAACACGGATGATACCATCGGGGACCTTAAGAAGCTGATTGCAGCCCAAACTGGTACCCGTTGGAACAAGATTGTCCTGAAGAAGTGGTACACGATTTTTAAGGACCACGTGTCTCTGGGGGACTATGAAATCCACGATGGGATGAACCTGGAGCTTTATTATCAATAGATGAGAATCCTCATCTTCCTGCCCCGCTTTCCTCTCCCATCCTCATCCCCCACACTGGGATAGATGCTTGTTTGTAAAAACTCACCTTAATAAAGACTTAGATGTTG

Publications

PMID - Link Title