Retrocopy Name | NDUFB9P1 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr5:69349957-69350406 UCSC | |
Coordinates (T2T) | chr5:70175742-70176191 UCSC | |
Coordinates (hg19) | chr5:68645784-68646233 UCSC | |
Strand | + | |
Parental Sequence | NM_005005.3 | |
Parental seq. overlap | 380 bp | |
Parental seq. overlap (%) | 54% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | NDUFB9P1, located on chr5:69349957-69350406, is a retrocopy of the parental gene NDUFB9. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | NDUFB9 |
Full Name | NADH:ubiquinone oxidoreductase subunit B9 |
Also known as | B22|CI-B22|LYRM3|MC1DN24|UQOR22 |
Coordinate | chr8:124539123-124549979 |
Strand | + |
Gene summary | The protein encoded by this gene is a subunit of the mitochondrial oxidative phosphorylation complex I (nicotinamide adenine dinucleotide: ubiquinone oxidoreductase). Complex I is localized to the inner mitochondrial membrane and functions to dehydrogenate nicotinamide adenine dinucleotide and to shuttle electrons to coenzyme Q. Complex I deficiency is the most common defect found in oxidative phosphorylation disorders and results in a range of conditions, including lethal neonatal disease, hypertrophic cardiomyopathy, liver disease, and adult-onset neurodegenerative disorders. Pseudogenes of this gene are found on chromosomes five, seven and eight. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015] |
Species | Scientific Name | Retrocopy | |
![]() |
Bonobo | Pan paniscus | NDUFB9P1 |
![]() |
Gorilla | Gorilla gorilla | NDUFB9P3 |
![]() |
Orangutan | Pongo abelii | NDUFB9P1 |
![]() |
Gibbon | Nomascus leucogenys | NDUFB9P3 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | NDUFB9P1 |
![]() |
Marmoset | Callithrix jacchus | NDUFB9P1 |
![]() |
Chimpanzee | Pan troglodytes | Without Homology |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>NDUFB9P1 |
GCCTACTTGACCTATCACCAGAAGGTGTTGCTGCTTTGTAACCAGGCGCTGTACCACCTCAAGCCATGGTGCATCCAGAGATAAATAATGGTATATTTTGCCTGTTTGATGAGAGCCTGGTTTGAAGAGCATAGGAAAAAAAAAAAGGGTATGATGGAGGCTACCCCACTGCTGAGGGAGGCAGAGGAATTCTGGTATCGTCAGCATTCACAGCCATTCTCTTCCCTGACTCTCTGGGGGTACTTCCTATGAGAGATACGAGTGATATGCTACAAGTCTCTGGAGTGGTGCTTAGATGACTGGAATCCTTCTGAGAAGGCAATGTACCCTGATTACTTAGCCAAGAGAGAGCAGTGGAAGAAACTGCTGAGGCAAAGCCAGGAGTGAGAGGTTAAGCAGCTGCAGGAGGAAATCCCAACTGGTGGTCTAGGACTGAAGCTTTGCCCCCTG |
>NM_005005.3 |
AGTCACCCGCAGCAGGCGTGCAGTTTCCCGGCTCTCCGCGCGGCCGGGGAAGGTCAGCGCCGTAATGGCGTTCTTGGCGTCGGGACCCTACCTGACCCATCAGCAAAAGGTGTTGCGGCTTTATAAGCGGGCGCTACGCCACCTCGAGTCGTGGTGCGTCCAGAGAGACAAATACCGATACTTTGCTTGTTTGATGAGAGCCCGGTTTGAAGAACATAAGAATGAAAAGGATATGGCGAAGGCCACCCAGCTGCTGAAGGAGGCCGAGGAAGAATTCTGGTACCGTCAGCATCCACAGCCATACATCTTCCCTGACTCTCCTGGGGGCACCTCCTATGAGAGATACGATTGCTACAAGGTCCCAGAATGGTGCTTAGATGACTGGCATCCTTCTGAGAAGGCAATGTATCCTGATTACTTTGCCAAGAGAGAACAGTGGAAGAAACTGCGGAGGGAAAGCTGGGAACGAGAGGTTAAGCAGCTGCAGGAGGAAACGCCACCTGGTGGTCCTTTAACTGAAGCTTTGCCCCCTGCCCGAAAGGAAGGTGATTTGCCCCCACTGTGGTGGTATATTGTGACCAGACCCCGGGAGCGGCCCATGTAGAAAGAGAGAGACCTCATCTTTCATGCTTGCAAGTGAAATATGTTACAGAACATGCACTTGCCCTAATAAAAAATCAGTGAAATGGTC |
PMID - Link | Title |
---|