Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name NDUFB9P1
Wait
Plot displaying the genomic locations of a retrocopy (in chr5) and its respective parental gene (in chr8). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr5:69349957-69350406  UCSC
Coordinates (T2T) chr5:70175742-70176191  UCSC
Coordinates (hg19) chr5:68645784-68646233  UCSC
Strand +
Parental Sequence NM_005005.3
Parental seq. overlap 380 bp
Parental seq. overlap (%) 54%
Genomic Region Intergenic
Retrocopy Summary NDUFB9P1, located on chr5:69349957-69350406, is a retrocopy of the parental gene NDUFB9. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name NDUFB9
Full Name NADH:ubiquinone oxidoreductase subunit B9
Also known as B22|CI-B22|LYRM3|MC1DN24|UQOR22
Coordinate chr8:124539123-124549979
Strand +
Gene summary The protein encoded by this gene is a subunit of the mitochondrial oxidative phosphorylation complex I (nicotinamide adenine dinucleotide: ubiquinone oxidoreductase). Complex I is localized to the inner mitochondrial membrane and functions to dehydrogenate nicotinamide adenine dinucleotide and to shuttle electrons to coenzyme Q. Complex I deficiency is the most common defect found in oxidative phosphorylation disorders and results in a range of conditions, including lethal neonatal disease, hypertrophic cardiomyopathy, liver disease, and adult-onset neurodegenerative disorders. Pseudogenes of this gene are found on chromosomes five, seven and eight. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]

Homology

Species Scientific Name Retrocopy
Bonobo Pan paniscus NDUFB9P1
Gorilla Gorilla gorilla NDUFB9P3
Orangutan Pongo abelii NDUFB9P1
Gibbon Nomascus leucogenys NDUFB9P3
Golden snub-nosed monkey Rhinopithecus roxellana NDUFB9P1
Marmoset Callithrix jacchus NDUFB9P1
Chimpanzee Pan troglodytes Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Adipose SubcutaneousMuscle SkeletalArtery TibialArtery CoronaryHeart Atrial AppendageAdipose VisceralUterusVaginaBreast Mammary TissueSkin Not Sun ExposedMinor Salivary GlandBrain CortexAdrenal GlandThyroidLungSpleenPancreasEsophagus MuscularisEsophagus MucosaEsophagus Gastroesophageal JunctionStomachColon SigmoidSmall Intestine Terminal IleumColon TransverseProstateTestisNerve TibialSkin Sun ExposedHeart Left VentricleBrain CerebellumWhole BloodArtery AortaPituitaryBrain Frontal CortexBrain CaudateBrain Nucleus AccumbensBrain PutamenBrain HypothalamusBrain Spinal CordBrain HippocampusBrain Anterior Cingulate CortexOvaryBrain Cerebellar HemisphereLiverBrain Substantia NigraKidney CortexBrain AmygdalaCervix EctocervixFallopian TubeCervix EndocervixBladderKidney Medulla00.10.20.30.4
log10(TPM+1)

Massive Mining of Publicly Available RNA-seq Data from Human and Mouse - (ARCHS4)

Related Sequence

>NDUFB9P1
GCCTACTTGACCTATCACCAGAAGGTGTTGCTGCTTTGTAACCAGGCGCTGTACCACCTCAAGCCATGGTGCATCCAGAGATAAATAATGGTATATTTTGCCTGTTTGATGAGAGCCTGGTTTGAAGAGCATAGGAAAAAAAAAAAGGGTATGATGGAGGCTACCCCACTGCTGAGGGAGGCAGAGGAATTCTGGTATCGTCAGCATTCACAGCCATTCTCTTCCCTGACTCTCTGGGGGTACTTCCTATGAGAGATACGAGTGATATGCTACAAGTCTCTGGAGTGGTGCTTAGATGACTGGAATCCTTCTGAGAAGGCAATGTACCCTGATTACTTAGCCAAGAGAGAGCAGTGGAAGAAACTGCTGAGGCAAAGCCAGGAGTGAGAGGTTAAGCAGCTGCAGGAGGAAATCCCAACTGGTGGTCTAGGACTGAAGCTTTGCCCCCTG
>NM_005005.3
AGTCACCCGCAGCAGGCGTGCAGTTTCCCGGCTCTCCGCGCGGCCGGGGAAGGTCAGCGCCGTAATGGCGTTCTTGGCGTCGGGACCCTACCTGACCCATCAGCAAAAGGTGTTGCGGCTTTATAAGCGGGCGCTACGCCACCTCGAGTCGTGGTGCGTCCAGAGAGACAAATACCGATACTTTGCTTGTTTGATGAGAGCCCGGTTTGAAGAACATAAGAATGAAAAGGATATGGCGAAGGCCACCCAGCTGCTGAAGGAGGCCGAGGAAGAATTCTGGTACCGTCAGCATCCACAGCCATACATCTTCCCTGACTCTCCTGGGGGCACCTCCTATGAGAGATACGATTGCTACAAGGTCCCAGAATGGTGCTTAGATGACTGGCATCCTTCTGAGAAGGCAATGTATCCTGATTACTTTGCCAAGAGAGAACAGTGGAAGAAACTGCGGAGGGAAAGCTGGGAACGAGAGGTTAAGCAGCTGCAGGAGGAAACGCCACCTGGTGGTCCTTTAACTGAAGCTTTGCCCCCTGCCCGAAAGGAAGGTGATTTGCCCCCACTGTGGTGGTATATTGTGACCAGACCCCGGGAGCGGCCCATGTAGAAAGAGAGAGACCTCATCTTTCATGCTTGCAAGTGAAATATGTTACAGAACATGCACTTGCCCTAATAAAAAATCAGTGAAATGGTC

Publications

PMID - Link Title
No publications available for this retrocopy