Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPS24P12
Plot displaying the genomic locations of a retrocopy (in chr6) and its respective parental gene (in chr10). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr6:107229785-107230154  UCSC
Coordinates (T2T) chr6:108408680-108409049  UCSC
Coordinates (hg19) chr6:107550989-107551358  UCSC
Strand +
Parental Sequence NM_001026.5
Parental seq. overlap 314 bp
Parental seq. overlap (%) 59.8%
Genomic Region Intragenic (PDSS2)
Retrocopy Summary RPS24P12, located on chr6:107229785-107230154, is a retrocopy of the parental gene RPS24. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPS24
Full Name ribosomal protein S24
Also known as DBA3|S24|eS24
Coordinate chr10:78033863-78056806
Strand +
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S24E family of ribosomal proteins. It is located in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Mutations in this gene result in Diamond-Blackfan anemia. [provided by RefSeq, Nov 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPS24P8
Bonobo Pan paniscus RPS24P7
Gorilla Gorilla gorilla RPS24P8
Orangutan Pongo abelii RPS24P8
Gibbon Nomascus leucogenys RPS24P2
Green monkey Chlorocebus sabaeus RPS24P10
Crab-eating macaque Macaca fascicularis RPS24P9
Rhesus Macaca mulatta RPS24P9
Baboon Papio anubis RPS24P9
Golden snub-nosed monkey Rhinopithecus roxellana RPS24P7
Mouse lemur Microcebus murinus RPS24P9
Dolphin Tursiops truncatus RPS24P6
Horse Equus caballus RPS24P5
Panda Ailuropoda melanoleuca RPS24P23
Velvety free-tailed bat Molossus molossus RPS24P34
Greater horseshoe bat Rhinolophus ferrumequinum RPS24P12
Egyptian rousette Rousettus aegyptiacus RPS24P2
Marmoset Callithrix jacchus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dog Canis familiaris Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPS24P12
GAAGTTCATGACCAACTGACTGACTACTTCAGTGGAAATACAACAAATGGTAATTGATGTCCTTTATCCTTGGAGGGCAACAGTACCTAAGGCAGAAATTCAGAGAAAATCTACCAAAATCTCACTGGATGTTATATTTGTATTTGGATTCAGAGCTCACATTGGTGGCGGCAAGAAAACTGGCTTTGGCATGATGTACGACTCGCTGGATTATGCAAAGAAATGTGAACCCAGATATGGACTTGAAAGATATAGCCTGTGTGAGAAGAAAAAGACCTGAAGAAACAAAAAAACTGAGCAAGAACAGAATGAAGTCAGTCAGGGAGACTGCAAAGGTCAAAGTTGGTGCTGGCAAAAACAAGGAGTAAAG
>NM_001026.5
CTCTTTTCCTCCTTGGCTGTCTGAAGATAGATCGCCATCATGAACGACACCGTAACTATCCGCACTAGAAAGTTCATGACCAACCGACTACTTCAGAGGAAACAAATGGTCATTGATGTCCTTCACCCCGGGAAGGCGACAGTGCCTAAGACAGAAATTCGGGAAAAACTAGCCAAAATGTACAAGACCACACCGGATGTCATCTTTGTATTTGGATTCAGAACTCATTTTGGTGGTGGCAAGACAACTGGCTTTGGCATGATTTATGATTCCCTGGATTATGCAAAGAAAAATGAACCCAAACATAGACTTGCAAGACATGGCCTGTATGAGAAGAAAAAGACCTCaagaaagcaacgaaaggaacgcaagaacagaatgaagaaagTCAGGGGGACTGCAAAGGCCAATGTTGGTGCTGGCAAAAAGCCGAAGGAGTAAAGGTGCTGCAATGATGTTAGCTGTGGCCACTGTGGATTTTTCGCAAGAACATTAATAAACTAAAAACTTCA

Publications

PMID - Link Title