Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name NUDT15P1
Plot displaying the genomic locations of a retrocopy (in chr6) and its respective parental gene (in chr13). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr6:17757964-17758126  UCSC
Coordinates (T2T) chr6:17630217-17630379  UCSC
Coordinates (hg19) chr6:17758195-17758357  UCSC
Strand -
Parental Sequence NM_001304745.2
Parental seq. overlap 136 bp
Parental seq. overlap (%) 17.8%
Genomic Region Intergenic
Retrocopy Summary NUDT15P1, located on chr6:17757964-17758126, is a retrocopy of the parental gene NUDT15. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name NUDT15
Full Name nudix hydrolase 15
Also known as MTH2|NUDT15D
Coordinate chr13:48037726-48047221
Strand +
Gene summary This gene encodes an enzyme that belongs to the Nudix hydrolase superfamily. Members of this superfamily catalyze the hydrolysis of nucleoside diphosphates, including substrates like 8-oxo-dGTP, which are a result of oxidative damage, and can induce base mispairing during DNA replication, causing transversions. The encoded enzyme is a negative regulator of thiopurine activation and toxicity. Mutations in this gene result in poor metabolism of thiopurines, and are associated with thiopurine-induced early leukopenia. Multiple pseudogenes of this gene have been identified. [provided by RefSeq, Apr 2016]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes NUDT15P1
Bonobo Pan paniscus NUDT15P1
Gorilla Gorilla gorilla NUDT15P2
Gibbon Nomascus leucogenys NUDT15P1
Mouse lemur Microcebus murinus NUDT15P2
Orangutan Pongo abelii Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>NUDT15P1
GGAGTGGGAGTCATGGGGACCAGCTGCAGCATTCTCATTGTGTCCTCCTGGGGAGAGGAAAGGGTCATTTGGAGCTGCCAGTTTCCCTTCCTGGGGGCCTTTGGGGGTTTGGTGAGAACTGGAAAGAATTTGCTCAAAGGGAAACCAGAAAAGAAGCAGCTCC
>NM_001304745.2
AGGCGCGTCCTCCCGCGCGCTATGACGGCCAGCGCACAGCCGCGCGGGCGGCGGCCAGGAGTCGGAGTCGGAGTCGTGGTGACCAGCTGCAAGCATCCGCGTTGCGTCCTCCTGGGGAAGAGGAAAGGCTCGGTTGGAGCTGGCAGTTTCCAACTCCCTGGAGGTCATCTGGAGTTCGGTGAAACCTGGGAAGAATGTGCTCAAAGGGAAACCTGGGAAGAAGCAGCTCTTCACCTGAAAAATGTTCACTTTGCCTCAGTTGTGAATTCTTTCATTGAGAAGGAGAATTACCATTATGTTACTATATTAATGAAAGGAGAAGTGGATGTGACTCATGATTCAGAACCAAAGAATGTAGAGCCTGAAAAAAATGAAAGTAAGAGAATTATATATAATCATGCATTTTTCTTTCAGGAGAGCAAGTGGTCTGGAGGAATATTACAGTATGTTGCCATATGAAGAGAAtgctattgtctgaatgcttgtgttcccccaaaattctatgtagaaatcctaactcccatgacgaggttttaggaggttggggcccttgggaggtgattagatcataagataatgaatgggattcatgcccttataaaagagacccctgaccccttccatgatgtaaagatacagagagaagatcgttgtctgtgaacctggaagtgggccctccccagatatggaatctgccagtgtcttgatcttggacttcccagtctctagaactgttgagaaataaatttctgttgctcataa

Publications

PMID - Link Title