Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPLP2P1
Plot displaying the genomic locations of a retrocopy (in chr6) and its respective parental gene (in chr11). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr6:27965214-27965471  UCSC
Coordinates (T2T) chr6:27834871-27835128  UCSC
Coordinates (hg19) chr6:27932992-27933249  UCSC
Strand +
Parental Sequence NM_001004.4
Parental seq. overlap 225 bp
Parental seq. overlap (%) 48.6%
Genomic Region Intergenic
Retrocopy Summary RPLP2P1, located on chr6:27965214-27965471, is a retrocopy of the parental gene RPLP2. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPLP2
Full Name ribosomal protein lateral stalk subunit P2
Also known as D11S2243E|LP2|P2|RPP2
Coordinate chr11:809967-812876
Strand +
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal phosphoprotein that is a component of the 60S subunit. The protein, which is a functional equivalent of the E. coli L7/L12 ribosomal protein, belongs to the L12P family of ribosomal proteins. It plays an important role in the elongation step of protein synthesis. Unlike most ribosomal proteins, which are basic, the encoded protein is acidic. Its C-terminal end is nearly identical to the C-terminal ends of the ribosomal phosphoproteins P0 and P1. The P2 protein can interact with P0 and P1 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPLP2P2
Bonobo Pan paniscus RPLP2P2
Gorilla Gorilla gorilla RPLP2P3
Orangutan Pongo abelii RPLP2P2
Gibbon Nomascus leucogenys RPLP2P4
Marmoset Callithrix jacchus RPLP2P1
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPLP2P1
AGCAACACCTCCCTTAGTGCCAAGGACATTAAGAAGATCCTGGACAGAGTAGGCATGGAGGCAACTGATGACTGGCTAAACAAGGTTATCAGTGAGCTGAATGGAAAAAATATTGAAGATATCATTGCCCAAGGTATTGGTGAGCTTGCCAGTGTGCCTGCTGGTGGGGCTGTGGCCCTCTCTGCTTCTCTGGGCTCTGCAGGTCCTGCTGCTGGTTCTACCCCTGCTGCAGAAGAAAGATGACAAGAAGGAGGAGTC
>NM_001004.4
CCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTccgccgcctccgccgcagacgccgccgcGATGCGCTACGTCGCCTCCTACCTGCTGGCTGCCCTAGGGGGCAACTCCTCCCCCAGCGCCAAGGACATCAAGAAGATCTTGGACAGCGTGGGTATCGAGGCGGACGACGACCGGCTCAACAAGGTTATCAGTGAGCTGAATGGAAAAAACATTGAAGACGTCATTGCCCAGGGTATTGGCAAGCTTGCCAGTGTACctgctggtggggctgtagccgtctctgctgccccaggctctgcagcccctgctgctggttctgcccctgctgcAGCAGAGGAGAAGAAAGATGAGAAGAAGGAGGAGTCTGAAGAGTCAGATGATGACATGGGATTTGGCCTTTTTGATTAAATTCCTGCTCCCCTGCAAATAAAGCCTTTTTACACATCTC

Publications

PMID - Link Title