Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name DBIP1
Wait
Plot displaying the genomic locations of a retrocopy (in chr6) and its respective parental gene (in chr2). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr6:79436690-79437224  UCSC
Coordinates (T2T) chr6:80642201-80642735  UCSC
Coordinates (hg19) chr6:80146407-80146941  UCSC
Strand -
Parental Sequence NM_001079862.4
Parental seq. overlap 480 bp
Parental seq. overlap (%) 85.1%
Genomic Region Intergenic
Retrocopy Summary DBIP1, located on chr6:79436690-79437224, is a retrocopy of the parental gene DBI. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name DBI
Full Name diazepam binding inhibitor, acyl-CoA binding protein
Also known as ACBD1|ACBP|CCK-RP|EP
Coordinate chr2:119366977-119372543
Strand +
Gene summary This gene encodes diazepam binding inhibitor, a protein that is regulated by hormones and is involved in lipid metabolism and the displacement of beta-carbolines and benzodiazepines, which modulate signal transduction at type A gamma-aminobutyric acid receptors located in brain synapses. The protein is conserved from yeast to mammals, with the most highly conserved domain consisting of seven contiguous residues that constitute the hydrophobic binding site for medium- and long-chain acyl-Coenzyme A esters. Diazepam binding inhibitor is also known to mediate the feedback regulation of pancreatic secretion and the postprandial release of cholecystokinin, in addition to its role as a mediator in corticotropin-dependent adrenal steroidogenesis. Three pseudogenes located on chromosomes 6, 8 and 16 have been identified. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes DBIP2
Bonobo Pan paniscus DBIP2
Gorilla Gorilla gorilla DBIP2
Orangutan Pongo abelii DBIP2
Gibbon Nomascus leucogenys DBIP2
Green monkey Chlorocebus sabaeus DBIP3
Crab-eating macaque Macaca fascicularis DBIP1
Rhesus Macaca mulatta DBIP1
Baboon Papio anubis DBIP2
Golden snub-nosed monkey Rhinopithecus roxellana DBIP2
Marmoset Callithrix jacchus DBIP2
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Related Sequence

>DBIP1
GCTTCCTGCTCCTCTCCTCCTCCACGGGCTCCCTGGAGTCCTTGCAAGCTGGCCAGGATGTCTCAGGCTGAGTTTGAGAGAGCTGTGGAAGACGTTAAACACCTTAAGACCAAGCCAGGGGATGATGAGATGTGTTCCTCTATGGCCACTACAAACAAGCAACTGTGGGCGACATAAATACAGAATGGCCTGGGATGTTGGATTTCAAAGGCAAGACCAAGTGGGATGCCTGGAATGAGCTGAAAGGGACTACCAAGGAAGATGCCATGAAAGCTTACGTCAACAATGTAGAAGAGCTAAGGAAAAAACATGGAATGTAAGAGACTGGATTTGGTTGCCAGCCATGTGTTTATCCTAAACTGAGACAGTGCCTTGTTTTTCCTAATACTGCAGATGATGGAAACTAGGGAAAATAACCAGTTAACCCAGCTCCTCAAGGCTGCTCACCATAGGGCTCTAACAGATTAGGGGCTAAAACAATTACTGACCTTCTCTGAGTAGTTTTTATCTGATATCAATTAAAAGTGTATTTGTG
>NM_001079862.4
AGTGCAATCTGGGCGATCGCTTCCTGGTCCTCGCCTCCTCCGCTGTCTCCCTGGAGTTCTTGCAAGTCGGCCAGGATGTCTCAGGCTGAGTTTGAGAAAGCTGCAGAGGAGGTTAGGCACCTTAAGACCAAGCCATCGGATGAGGAGATGCTGTTCATCTATGGCCACTACAAACAAGCAACTGTGGGCGACATAAATACAGAACGGCCCGGGATGTTGGACTTCACGGGCAAGGCCAAGTGGGATGCCTGGAATGAGCTGAAAGGGACTTCCAAGGAAGATGCCATGAAAGCTTACATCAACAAAGTAGAAGAGCTAAAGAAAAAATACGGGATATGAGAGACTGGATTTGGTTACTGTGCCATGTGTTTATCCTAAACTGAGACAATGCCTTGTTTTTTTCTAATACCGTGGATGGTGGGAATTCGGGAAAATAACCAGTTAAACCAGCTACTCAAGGCTGCTCACCATACGGCTCTAACAGATTAGGGGCTAAAACGATTACTGACTTTCCTTGAGTAGTTTTTATCTGAAATCAATTAAAAGTGTATTTGTTACTTTAAA

Publications

PMID - Link Title
No publications available for this retrocopy