Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name PTTG1P1
Plot displaying the genomic locations of a retrocopy (in chr6) and its respective parental gene (in chr5). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr6:80499131-80499429  UCSC
Coordinates (T2T) chr6:81707486-81707784  UCSC
Coordinates (hg19) chr6:81208848-81209146  UCSC
Strand -
Parental Sequence NM_004219.4
Parental seq. overlap 243 bp
Parental seq. overlap (%) 33.7%
Genomic Region Intergenic
Retrocopy Summary PTTG1P1, located on chr6:80499131-80499429, is a retrocopy of the parental gene PTTG1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name PTTG1
Full Name PTTG1 regulator of sister chromatid separation, securin
Also known as EAP1|ECRAR|HPTTG|PTTG|TUTR1
Coordinate chr5:160421855-160428744
Strand +
Gene summary The encoded protein is a homolog of yeast securin proteins, which prevent separins from promoting sister chromatid separation. It is an anaphase-promoting complex (APC) substrate that associates with a separin until activation of the APC. The gene product has transforming activity in vitro and tumorigenic activity in vivo, and the gene is highly expressed in various tumors. The gene product contains 2 PXXP motifs, which are required for its transforming and tumorigenic activities, as well as for its stimulation of basic fibroblast growth factor expression. It also contains a destruction box (D box) that is required for its degradation by the APC. The acidic C-terminal region of the encoded protein can act as a transactivation domain. The gene product is mainly a cytosolic protein, although it partially localizes in the nucleus. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes PTTG1P2
Bonobo Pan paniscus PTTG1P2
Gorilla Gorilla gorilla PTTG1P2
Orangutan Pongo abelii PTTG1P2
Gibbon Nomascus leucogenys PTTG1P5
Crab-eating macaque Macaca fascicularis PTTG1P2
Rhesus Macaca mulatta PTTG1P2
Baboon Papio anubis PTTG1P3
Golden snub-nosed monkey Rhinopithecus roxellana PTTG1P2
Green monkey Chlorocebus sabaeus Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>PTTG1P1
TGAGAGTTTTCACCTTGTTGAAGAGCACCAGATTGCACATTCCTTTGAATGGAATGCCTCTTATGATCCTTGAAGAGGAGAGGGAATTTAAAAGCTGTTGTAGCTGGGTTCCCCTTCACTTGTGAAGATGCTGCCTCCACCATGAGAGTCCAATCCACTGTAGTCTCTTTCAAGCATTTCACCAACCCTGGATGTTGAATTAGCACCTGTTTACTATGACACAGATATTTAAATATTTTAGTTCTTTATAGATTGTCTTGTGTGTGTTTGTGTTAATAAAGCATTTCTTTAACAGAA
>NM_004219.4
ACCGCGGCCTCAGATGAATGCGGCTGTTAAGACCTGCAATAATCCAGAATGGCTACTCTGATCTATGTTGATAAGGAAAATGGAGAACCAGGCACCCGTGTGGTTGCTAAGGATGGGCTGAAGCTGGGGTCTGGACCTTCAATCAAAGCCTTAGATGGGAGATCTCAAGTTTCAACACCACGTTTTGGCAAAACGTTCGATGCCCCACCAGCCTTACCTAAAGCTACTAGAAAGGCTTTGGGAACTGTCAACAGAGCTACAGAAAAGTCTGTAAAGACCAAGGGACCCCTCAAACAAAAACAGCCAAGCTTTTCTGCCAAAAAGATGACTGAGAAGACTGTTAAAGCAAAAAGCTCTGTTCCTGCCTCAGATGATGCCTATCCAGAAATAGAAAAATTCTTTCCCTTCAATCCTCTAGACTTTGAGAGTTTTGACCTGCCTGAAGAGCACCAGATTGCGCACCTCCCCTTGAGTGGAGTGCCTCTCATGATCCTTGACGAGGAGAGAGAGCTTGAAAAGCTGTTTCAGCTGGGCCCCCCTTCACCTGTGAAGATGCCCTCTCCACCATGGGAATCCAATCTGTTGCAGTCTCCTTCAAGCATTCTGTCGACCCTGGATGTTGAATTGCCACCTGTTTGCTGTGACATAGATATTTAAATTTCTTAGTGCTTCAGAGTTTGTGTGTATTTGTATTAATAAAGCATTCTTTAACAGA

Publications

PMID - Link Title