Retrocopy Name | PTTG1P1 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr6:80499131-80499429 UCSC | |
Coordinates (T2T) | chr6:81707486-81707784 UCSC | |
Coordinates (hg19) | chr6:81208848-81209146 UCSC | |
Strand | - | |
Parental Sequence | NM_004219.4 | |
Parental seq. overlap | 243 bp | |
Parental seq. overlap (%) | 33.7% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | PTTG1P1, located on chr6:80499131-80499429, is a retrocopy of the parental gene PTTG1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | PTTG1 |
Full Name | PTTG1 regulator of sister chromatid separation, securin |
Also known as | EAP1|ECRAR|HPTTG|PTTG|TUTR1 |
Coordinate | chr5:160421855-160428744 |
Strand | + |
Gene summary | The encoded protein is a homolog of yeast securin proteins, which prevent separins from promoting sister chromatid separation. It is an anaphase-promoting complex (APC) substrate that associates with a separin until activation of the APC. The gene product has transforming activity in vitro and tumorigenic activity in vivo, and the gene is highly expressed in various tumors. The gene product contains 2 PXXP motifs, which are required for its transforming and tumorigenic activities, as well as for its stimulation of basic fibroblast growth factor expression. It also contains a destruction box (D box) that is required for its degradation by the APC. The acidic C-terminal region of the encoded protein can act as a transactivation domain. The gene product is mainly a cytosolic protein, although it partially localizes in the nucleus. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | PTTG1P2 |
![]() |
Bonobo | Pan paniscus | PTTG1P2 |
![]() |
Gorilla | Gorilla gorilla | PTTG1P2 |
![]() |
Orangutan | Pongo abelii | PTTG1P2 |
![]() |
Gibbon | Nomascus leucogenys | PTTG1P5 |
![]() |
Crab-eating macaque | Macaca fascicularis | PTTG1P2 |
![]() |
Rhesus | Macaca mulatta | PTTG1P2 |
![]() |
Baboon | Papio anubis | PTTG1P3 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | PTTG1P2 |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>PTTG1P1 |
TGAGAGTTTTCACCTTGTTGAAGAGCACCAGATTGCACATTCCTTTGAATGGAATGCCTCTTATGATCCTTGAAGAGGAGAGGGAATTTAAAAGCTGTTGTAGCTGGGTTCCCCTTCACTTGTGAAGATGCTGCCTCCACCATGAGAGTCCAATCCACTGTAGTCTCTTTCAAGCATTTCACCAACCCTGGATGTTGAATTAGCACCTGTTTACTATGACACAGATATTTAAATATTTTAGTTCTTTATAGATTGTCTTGTGTGTGTTTGTGTTAATAAAGCATTTCTTTAACAGAA |
>NM_004219.4 |
ACCGCGGCCTCAGATGAATGCGGCTGTTAAGACCTGCAATAATCCAGAATGGCTACTCTGATCTATGTTGATAAGGAAAATGGAGAACCAGGCACCCGTGTGGTTGCTAAGGATGGGCTGAAGCTGGGGTCTGGACCTTCAATCAAAGCCTTAGATGGGAGATCTCAAGTTTCAACACCACGTTTTGGCAAAACGTTCGATGCCCCACCAGCCTTACCTAAAGCTACTAGAAAGGCTTTGGGAACTGTCAACAGAGCTACAGAAAAGTCTGTAAAGACCAAGGGACCCCTCAAACAAAAACAGCCAAGCTTTTCTGCCAAAAAGATGACTGAGAAGACTGTTAAAGCAAAAAGCTCTGTTCCTGCCTCAGATGATGCCTATCCAGAAATAGAAAAATTCTTTCCCTTCAATCCTCTAGACTTTGAGAGTTTTGACCTGCCTGAAGAGCACCAGATTGCGCACCTCCCCTTGAGTGGAGTGCCTCTCATGATCCTTGACGAGGAGAGAGAGCTTGAAAAGCTGTTTCAGCTGGGCCCCCCTTCACCTGTGAAGATGCCCTCTCCACCATGGGAATCCAATCTGTTGCAGTCTCCTTCAAGCATTCTGTCGACCCTGGATGTTGAATTGCCACCTGTTTGCTGTGACATAGATATTTAAATTTCTTAGTGCTTCAGAGTTTGTGTGTATTTGTATTAATAAAGCATTCTTTAACAGA |
PMID - Link | Title |
---|