| Retrocopy Name | RPL29P47 |
|
| Species | Homo sapiens | |
| Coordinates (hg38) | chr7:130255872-130256071 UCSC | |
| Coordinates (T2T) | chr7:131569258-131569457 UCSC | |
| Coordinates (hg19) | chr7:129895712-129895911 UCSC | |
| Strand | + | |
| Parental Sequence | NM_000992.3 | |
| Parental seq. overlap | 179 bp | |
| Parental seq. overlap (%) | 23.7% | |
| Genomic Region |
Intergenic |
|
| Retrocopy Summary | RPL29P47, located on chr7:130255872-130256071, is a retrocopy of the parental gene RPL29. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | RPL29 |
| Full Name | ribosomal protein L29 |
| Also known as | HIP|HUMRPL29|L29|RPL29P10|RPL29_3_370 |
| Coordinate | chr3:51993522-51995895 |
| Strand | - |
| Gene summary | Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a cytoplasmic ribosomal protein that is a component of the 60S subunit. The protein belongs to the L29E family of ribosomal proteins. The protein is also a peripheral membrane protein expressed on the cell surface that directly binds heparin. Although this gene was previously reported to map to 3q29-qter, it is believed that it is located at 3p21.3-p21.2. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008] |
| Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | RPL29P14 |
![]() |
Bonobo | Pan paniscus | RPL29P15 |
![]() |
Gorilla | Gorilla gorilla | RPL29P12 |
![]() |
Orangutan | Pongo abelii | RPL29P12 |
![]() |
Gibbon | Nomascus leucogenys | RPL29P18 |
![]() |
Green monkey | Chlorocebus sabaeus | RPL29P27 |
![]() |
Crab-eating macaque | Macaca fascicularis | RPL29P5 |
![]() |
Rhesus | Macaca mulatta | RPL29P5 |
![]() |
Baboon | Papio anubis | RPL29P8 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | RPL29P11 |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >RPL29P47 |
| ACTTCGGGAGCCACAGGTTATGGTGCAGACATGGCCAAGTCCAACAACCATACCACACACAACCAGTCCTGAAAATGGCACAGAAATGGTATCAGGAAACCCTCATCATAAAGATATGCATCTTTTAAGGGGATGGACCCCATGTTCCTGAGGAACACGTGCTTTTCCAAGAAGCACAAGAAGGTCCTAAAGAAGATGCA |
| >NM_000992.3 |
| CTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCCAAGAACCACACCACACACAACCAGTCCCGAAAATGGCACAGAAATGGTATCAAGAAACCCCGATCACAAAGATACGAATCTCTTAAGGGGGTGGACCCCAAGTTCCTGAGGAACATGCGCTTTGCCAAGAAGCACAACAAAAAGGGCCTAAAGAAGATGCAGGCCAACAATGCCAAGGCCATGAGTGCACGTGCCGAGGCTATCAAGGCCCTCGTAAAGCCCAAGGAGGTTAAGCCCAAGATCCCAAAGGGTGTCAGCCGCAAGCTCGATCGACTTGCCTACATTGCCCACCCCAAGCTTGGGAAGCGTGCTCGTGCCCGTATTGCCAAGGggctcaggctgtgccggccaaaggccaaggccaaggccaaggccaaggatcaaaccaaggcccaggctgcagccccagcttcagttccagctcaggctcCCAAACGTACCCAGGCCCCTACAAAGGCTTCAGAGTAGATATCTCTGCCAACATGAGGACAGAAGGACTGGTGCGACCCCCCACCCCCGCCCCTGGGCTACCATCTGCATGGGGCTGGGGTCCTCCTGTGCTATTTGTACAAATAAACCTGAGGCAGGATTTGTTAGCCTCTGTCTATGATCCTGGGGATGGGTTTGGTTGCTCCATCTGTTGGTGTGGGAGAAGACATGGGTCTGGATGGTGGGGTGTGGGTGGGAGTCAGGAG |
| PMID - Link | Title |
|---|