| Retrocopy Name | EIF4EBP1P2 |
|
| Species | Homo sapiens | |
| Coordinates (hg38) | chr7:6026123-6026274 UCSC | |
| Coordinates (T2T) | chr7:6143898-6144049 UCSC | |
| Coordinates (hg19) | chr7:6065754-6065905 UCSC | |
| Strand | + | |
| Parental Sequence | NM_004095.4 | |
| Parental seq. overlap | 133 bp | |
| Parental seq. overlap (%) | 16.1% | |
| Genomic Region |
Intragenic (EIF2AK1) Intragenic (EIF2AK2) |
|
| Retrocopy Summary | EIF4EBP1P2, located on chr7:6026123-6026274, is a retrocopy of the parental gene EIF4EBP1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | EIF4EBP1 |
| Full Name | eukaryotic translation initiation factor 4E binding protein 1 |
| Also known as | 4E-BP1|4EBP1|BP-1|PHAS-I |
| Coordinate | chr8:38030534-38060365 |
| Strand | + |
| Gene summary | This gene encodes one member of a family of translation repressor proteins. The protein directly interacts with eukaryotic translation initiation factor 4E (eIF4E), which is a limiting component of the multisubunit complex that recruits 40S ribosomal subunits to the 5' end of mRNAs. Interaction of this protein with eIF4E inhibits complex assembly and represses translation. This protein is phosphorylated in response to various signals including UV irradiation and insulin signaling, resulting in its dissociation from eIF4E and activation of mRNA translation. [provided by RefSeq, Jul 2008] |
| Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | EIF4EBP1P1 |
![]() |
Bonobo | Pan paniscus | EIF4EBP1P1 |
![]() |
Gorilla | Gorilla gorilla | EIF4EBP1P1 |
![]() |
Orangutan | Pongo abelii | EIF4EBP1P1 |
![]() |
Gibbon | Nomascus leucogenys | EIF4EBP1P2 |
![]() |
Green monkey | Chlorocebus sabaeus | EIF4EBP1P3 |
![]() |
Crab-eating macaque | Macaca fascicularis | EIF4EBP1P1 |
![]() |
Baboon | Papio anubis | EIF4EBP1P1 |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >EIF4EBP1P2 |
| GGGCACACTCTTCAGCACTACCCGGGGAGGTACCAGGATCATGTACAACTGGAAATTCCCAATAGAGTGCTGAACTCACCAGTGACCAAAACACCCTCGAGGGACCCGCCCACCACTTCCGGGGTCACCAGCCCTGCCAGTGATGAGCCCCC |
| >NM_004095.4 |
| AGGGCAGCGAGAGGTTCGCGGGTGCAGCGCACAGGAGACCATGTCCGGGGGCAGCAGCTGCAGCCAGACCCCAAGCCGGGCCATCCCCGCCACTCGCCGGGTGGTGCTCGGCGACGGCGTGCAGCTCCCGCCCGGGGACTACAGCACGACCCCCGGCGGCACGCTCTTCAGCACCACCCCGGGAGGTACCAGGATCATCTATGACCGGAAATTCCTGATGGAGTGTCGGAACTCACCTGTGACCAAAACACCCCCAAGGGATCTGCCCACCATTCCGGGGGTCACCAGCCCTTCCAGTGATGAGCCCCCCATGGAAGCCAGCCAGAGCCACCTGCGCAATAGCCCAGAAGATAAGCGGGCGGGCGGTGAAGAGTCACAGTTTGAGATGGACATTTAAAGCACCAGCCATCGTGTGGAGCACTACCAAGGGGCCCCTCAGGGCCTTCCTGGGAGGAGTCCCACCAGCCAGGCCTTATGAAAGTGATCATACTGGGCAGGCGTTGGCGTGGGGTCGGACACCCCAGCCCTTTCTCCCTCACTCAGGGCACCTGCCCCCTCCTCTTCGTGAACACCAGCAGATACCTCCTTGTGCCTCCACTGATGCAGGAGCTGCCACCCCAAGGGGAGTGACCCCTGCCAGCACACCCTGCAGCCAAGGGCCAGGAAGTGGACAAGAACGAACCCTTCCTTCCGAATGATCAGCAGTTCCAGCCCCTCGCTGCTGGGGGCGCAACCACCCCTTCCTTAGGTTGATGTGCTTGGGAAAGCTCCCTCCCCCTCCTTCCCCAAGAGAGGAAATAAAAGCCACCTTCGCCCTAGGGCCAAGA |
| PMID - Link | Title |
|---|