Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name EIF4EBP1P2
Plot displaying the genomic locations of a retrocopy (in chr7) and its respective parental gene (in chr8). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr7:6026123-6026274  UCSC
Coordinates (T2T) chr7:6143898-6144049  UCSC
Coordinates (hg19) chr7:6065754-6065905  UCSC
Strand +
Parental Sequence NM_004095.4
Parental seq. overlap 133 bp
Parental seq. overlap (%) 16.1%
Genomic Region Intragenic (EIF2AK1)
Intragenic (EIF2AK2)
Retrocopy Summary EIF4EBP1P2, located on chr7:6026123-6026274, is a retrocopy of the parental gene EIF4EBP1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name EIF4EBP1
Full Name eukaryotic translation initiation factor 4E binding protein 1
Also known as 4E-BP1|4EBP1|BP-1|PHAS-I
Coordinate chr8:38030534-38060365
Strand +
Gene summary This gene encodes one member of a family of translation repressor proteins. The protein directly interacts with eukaryotic translation initiation factor 4E (eIF4E), which is a limiting component of the multisubunit complex that recruits 40S ribosomal subunits to the 5' end of mRNAs. Interaction of this protein with eIF4E inhibits complex assembly and represses translation. This protein is phosphorylated in response to various signals including UV irradiation and insulin signaling, resulting in its dissociation from eIF4E and activation of mRNA translation. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes EIF4EBP1P1
Bonobo Pan paniscus EIF4EBP1P1
Gorilla Gorilla gorilla EIF4EBP1P1
Orangutan Pongo abelii EIF4EBP1P1
Gibbon Nomascus leucogenys EIF4EBP1P2
Green monkey Chlorocebus sabaeus EIF4EBP1P3
Crab-eating macaque Macaca fascicularis EIF4EBP1P1
Baboon Papio anubis EIF4EBP1P1
Rhesus Macaca mulatta Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>EIF4EBP1P2
GGGCACACTCTTCAGCACTACCCGGGGAGGTACCAGGATCATGTACAACTGGAAATTCCCAATAGAGTGCTGAACTCACCAGTGACCAAAACACCCTCGAGGGACCCGCCCACCACTTCCGGGGTCACCAGCCCTGCCAGTGATGAGCCCCC
>NM_004095.4
AGGGCAGCGAGAGGTTCGCGGGTGCAGCGCACAGGAGACCATGTCCGGGGGCAGCAGCTGCAGCCAGACCCCAAGCCGGGCCATCCCCGCCACTCGCCGGGTGGTGCTCGGCGACGGCGTGCAGCTCCCGCCCGGGGACTACAGCACGACCCCCGGCGGCACGCTCTTCAGCACCACCCCGGGAGGTACCAGGATCATCTATGACCGGAAATTCCTGATGGAGTGTCGGAACTCACCTGTGACCAAAACACCCCCAAGGGATCTGCCCACCATTCCGGGGGTCACCAGCCCTTCCAGTGATGAGCCCCCCATGGAAGCCAGCCAGAGCCACCTGCGCAATAGCCCAGAAGATAAGCGGGCGGGCGGTGAAGAGTCACAGTTTGAGATGGACATTTAAAGCACCAGCCATCGTGTGGAGCACTACCAAGGGGCCCCTCAGGGCCTTCCTGGGAGGAGTCCCACCAGCCAGGCCTTATGAAAGTGATCATACTGGGCAGGCGTTGGCGTGGGGTCGGACACCCCAGCCCTTTCTCCCTCACTCAGGGCACCTGCCCCCTCCTCTTCGTGAACACCAGCAGATACCTCCTTGTGCCTCCACTGATGCAGGAGCTGCCACCCCAAGGGGAGTGACCCCTGCCAGCACACCCTGCAGCCAAGGGCCAGGAAGTGGACAAGAACGAACCCTTCCTTCCGAATGATCAGCAGTTCCAGCCCCTCGCTGCTGGGGGCGCAACCACCCCTTCCTTAGGTTGATGTGCTTGGGAAAGCTCCCTCCCCCTCCTTCCCCAAGAGAGGAAATAAAAGCCACCTTCGCCCTAGGGCCAAGA

Publications

PMID - Link Title