Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name PAGE4P2
Plot displaying the genomic locations of a retrocopy (in chr7) and its respective parental gene (in chrX). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr7:64566800-64567015  UCSC
Coordinates (T2T) chr7:65774305-65774520  UCSC
Coordinates (hg19) chr7:64027178-64027393  UCSC
Strand -
Parental Sequence NM_007003.4
Parental seq. overlap 186 bp
Parental seq. overlap (%) 23.5%
Genomic Region Intergenic
Retrocopy Summary PAGE4P2, located on chr7:64566800-64567015, is a retrocopy of the parental gene PAGE4. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name PAGE4
Full Name PAGE family member 4
Also known as CT16.7|GAGE-9|GAGEC1|JM-27|JM27|PAGE-1|PAGE-4
Coordinate chrX:49829260-49834264
Strand +
Gene summary This gene is a member of the GAGE family. The GAGE genes are expressed in a variety of tumors and in some fetal and reproductive tissues. This gene is strongly expressed in prostate and prostate cancer. It is also expressed in other male and female reproductive tissues including testis, fallopian tube, uterus, and placenta, as well as in testicular cancer and uterine cancer. The protein encoded by this gene shares sequence similarity with other GAGE/PAGE proteins, and also belongs to a family of CT (cancer-testis) antigens. The protein may play a role in benign and malignant prostate diseases. A related pseudogene is located on chromosome 7. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes PAGE4P2
Bonobo Pan paniscus PAGE4P2
Gorilla Gorilla gorilla PAGE4P1
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>PAGE4P2
AACTGAGAATTAGGATATTAAACCTGGACAAGAGAAAGAATAAACACCTGTGATTGAGCAACGTAAATTGGAAGCTGATTGCCGGAAATTGCATCTGGAAAAGACTGGGAGTAAGTGCAAAGATGGCCCTGATGTAAAAGAGAAGACTCCACCTAATCTGAAGCGTGCTAAGATTATAGAAGCAGGAGATGGGCAGCCATAAATTAAAAAGAAGAT
>NM_007003.4
GCCACTTCTCTTCCCTTCATTCTTCGCCAGGCTCTCTGCTGACTCAAGTTCTTCAGTTCACGATCTTCTAGTTGCAGCGATGAGTGCACGAGTGAGATCAAGATCCAGAGGAAGAGGAGATGGTCAGGAGGCTCCCGATGTGGTTGCATTCGTGGCTCCCGGTGAATCTCAGCAAGAGGAACCACCAACTGACAATCAGGATATTGAACCTGGACAAGAGAGAGAAGGAACACCTCCGATCGAAGAACGTAAAGTAGAAGGTGATTGCCAGGAAATGGATCTGGAAAAGACTCGGAGTGAGCGTGGAGATGGCTCTGATGTAAAAGAGAAGACTCCACCTAATCCTAAGCATGCTAAGACTAAAGAAGCAGGAGATGGGCAGCCATAAGTTAAAAAGAAGACAAGCTGAAGCTACACACATGGCTGATGTCACATTGAAAATGTGACTGAAAATTTGAaaattctctcaataaagtttgagttttctctgaagaagtcatgcgtgtcttttgtaaaatttattcctaggaaattgacactattgtaaatggtatctttaaaaaatccttgtgttctgtttagagctggtatatatttttgtatactgattttgtgttgggcaacattgctaaacttgcctattctgttggtttatccctacgtccttttggattttctccatacacaatcataccacatgtaaataatgataattctgttttttccttttgaggctttgtactttcatttctggtccttatgacactggccagacccctccagtacaatg

Publications

PMID - Link Title