| Retrocopy Name | PAGE4P2 |
|
| Species | Homo sapiens | |
| Coordinates (hg38) | chr7:64566800-64567015 UCSC | |
| Coordinates (T2T) | chr7:65774305-65774520 UCSC | |
| Coordinates (hg19) | chr7:64027178-64027393 UCSC | |
| Strand | - | |
| Parental Sequence | NM_007003.4 | |
| Parental seq. overlap | 186 bp | |
| Parental seq. overlap (%) | 23.5% | |
| Genomic Region |
Intergenic |
|
| Retrocopy Summary | PAGE4P2, located on chr7:64566800-64567015, is a retrocopy of the parental gene PAGE4. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | PAGE4 |
| Full Name | PAGE family member 4 |
| Also known as | CT16.7|GAGE-9|GAGEC1|JM-27|JM27|PAGE-1|PAGE-4 |
| Coordinate | chrX:49829260-49834264 |
| Strand | + |
| Gene summary | This gene is a member of the GAGE family. The GAGE genes are expressed in a variety of tumors and in some fetal and reproductive tissues. This gene is strongly expressed in prostate and prostate cancer. It is also expressed in other male and female reproductive tissues including testis, fallopian tube, uterus, and placenta, as well as in testicular cancer and uterine cancer. The protein encoded by this gene shares sequence similarity with other GAGE/PAGE proteins, and also belongs to a family of CT (cancer-testis) antigens. The protein may play a role in benign and malignant prostate diseases. A related pseudogene is located on chromosome 7. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016] |
| Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | PAGE4P2 |
![]() |
Bonobo | Pan paniscus | PAGE4P2 |
![]() |
Gorilla | Gorilla gorilla | PAGE4P1 |
![]() |
Orangutan | Pongo abelii | Without Homology |
![]() |
Gibbon | Nomascus leucogenys | Without Homology |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >PAGE4P2 |
| AACTGAGAATTAGGATATTAAACCTGGACAAGAGAAAGAATAAACACCTGTGATTGAGCAACGTAAATTGGAAGCTGATTGCCGGAAATTGCATCTGGAAAAGACTGGGAGTAAGTGCAAAGATGGCCCTGATGTAAAAGAGAAGACTCCACCTAATCTGAAGCGTGCTAAGATTATAGAAGCAGGAGATGGGCAGCCATAAATTAAAAAGAAGAT |
| >NM_007003.4 |
| GCCACTTCTCTTCCCTTCATTCTTCGCCAGGCTCTCTGCTGACTCAAGTTCTTCAGTTCACGATCTTCTAGTTGCAGCGATGAGTGCACGAGTGAGATCAAGATCCAGAGGAAGAGGAGATGGTCAGGAGGCTCCCGATGTGGTTGCATTCGTGGCTCCCGGTGAATCTCAGCAAGAGGAACCACCAACTGACAATCAGGATATTGAACCTGGACAAGAGAGAGAAGGAACACCTCCGATCGAAGAACGTAAAGTAGAAGGTGATTGCCAGGAAATGGATCTGGAAAAGACTCGGAGTGAGCGTGGAGATGGCTCTGATGTAAAAGAGAAGACTCCACCTAATCCTAAGCATGCTAAGACTAAAGAAGCAGGAGATGGGCAGCCATAAGTTAAAAAGAAGACAAGCTGAAGCTACACACATGGCTGATGTCACATTGAAAATGTGACTGAAAATTTGAaaattctctcaataaagtttgagttttctctgaagaagtcatgcgtgtcttttgtaaaatttattcctaggaaattgacactattgtaaatggtatctttaaaaaatccttgtgttctgtttagagctggtatatatttttgtatactgattttgtgttgggcaacattgctaaacttgcctattctgttggtttatccctacgtccttttggattttctccatacacaatcataccacatgtaaataatgataattctgttttttccttttgaggctttgtactttcatttctggtccttatgacactggccagacccctccagtacaatg |
| PMID - Link | Title |
|---|