Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name ATP5PBP2
Plot displaying the genomic locations of a retrocopy (in chr7) and its respective parental gene (in chr1). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr7:94739119-94739748  UCSC
Coordinates (T2T) chr7:95975009-95975638  UCSC
Coordinates (hg19) chr7:94368431-94369060  UCSC
Strand +
Parental Sequence NM_001688.5
Parental seq. overlap 403 bp
Parental seq. overlap (%) 15.3%
Genomic Region Intergenic
Retrocopy Summary ATP5PBP2, located on chr7:94739119-94739748, is a retrocopy of the parental gene ATP5PB. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name ATP5PB
Full Name ATP synthase peripheral stalk-membrane subunit b
Also known as ATP5F1|PIG47
Coordinate chr1:111449464-111462773
Strand +
Gene summary This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the b subunit of the proton channel. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes ATP5PBP3
Bonobo Pan paniscus ATP5PBP3
Gorilla Gorilla gorilla ATP5PBP2
Orangutan Pongo abelii ATP5PBP4
Gibbon Nomascus leucogenys ATP5PBP4
Green monkey Chlorocebus sabaeus ATP5F1P6
Crab-eating macaque Macaca fascicularis ATP5F1P1
Rhesus Macaca mulatta ATP5PBP1
Baboon Papio anubis ATP5PBP3
Golden snub-nosed monkey Rhinopithecus roxellana ATP5PBP4
Marmoset Callithrix jacchus ATP5PBP10
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>ATP5PBP2
TTGGTTCAGAAGTGCCATTACTATTTTGATGTCCAGAGGAATAACATTGCTATGGCTTTGGAGGTTATTTACTGGAAATGGCTGCATAGAGTATATAAGGTAAAGAATCACCTGGACTATCATATGTGTATGTAGAATATGATGCATCAAAAGGAAAAAGAGCACATGATCAACTGGGTGGAGAAGCACATGCTCCAGAGGATCTCTGCACAGCAGGAAAAGGAGACAGTTGCCAAGTGCATTGCAAACAAATCTAAAGCTGCTCTCAAAGAAGGCTCAAGCACAGCCAGTTCTGTCAGTGTATCCATCCCAACTGAGACAACTGAAACAACTGACCGACTAAATGAAAGGTAGTCTTTGTGCCAAAATCTTTCTGTATTGCTGTCTACTGAAGTTACAGTTTACTTTTCCTAAAAGTGAAAAGTTTGAGTGTCATTATAGTGAAAGAATTAAACCTATTGGCCAATCAGATGGGTCT
>NM_001688.5
CATCTTGGTCCTGCCCTGACAGATTCTCCTATCGGGGTCACAGGGACGCTAAGATTGCTACCTGGACTTTCGTTGACCATGCTGTCCCGGGTGGTACTTTCCGCCGCCGCCACAGCGGCCCCCTCTCTGAAGAATGCAGCCTTCCTAGGTCCAGGGGTATTGCAGGCAACAAGGACCTTTCATACAGGGCAGCCACACCTTGTCCCTGTACCACCTCTTCCTGAATACGGAGGAAAAGTTCGTTATGGACTGATCCCTGAGGAATTCTTCCAGTTTCTTTATCCTAAAACTGGTGTAACAGGACCCTATGTACTCGGAACTGGGCTTATCTTGTACGCTTTATCCAAAGAAATATATGTGATTAGCGCAGAGACCTTCACTGCCCTATCAGTACTAGGTGTAATGGTCTATGGAATTAAAAAATATGGTCCCTTTGTTGCAGACTTTGCTGATAAACTCAATGAGCAAAAACTTGCCCAACTAGAAGAGGCGAAGCAGGCTTCCATCCAACACATCCAGAATGCAATTGATACGGAGAAGTCACAACAGGCACTGGTTCAGAAGCGCCATTACCTTTTTGATGTGCAAAGGAATAACATTGCTATGGCTTTGGAAGTTACTTACCGGGAACGACTGTATAGAGTATATAAGGAAGTAAAGAATCGCCTGGACTATCATATATCTGTGCAGAACATGATGCGTCGAAAGGAACAAGAACACATGATAAATTGGGTGGAGAAGCACGTGGTGCAAAGCATCTCCACACAGCAGGAAAAGGAGACAATTGCCAAGTGCATTGCGGACCTAAAGCTGCTGGCAAAGAAGGCTCAAGCACAGCCAGTTATGTAAATGTATCTATCCCAATTGAGACAGCTAGAAACAGTTGACTGACTAAATGGAAACTAGTCTATTTGACAAAGTCTTTCTGTGTTGGTGTCTACTGAAGTTATAGTTTACCCTTCCTAAAAATGAAAAGTTTGTTTCATATAGTGAGAGAACGAAATCTCTATCGGCCAGTCAGATGTTTCTCATCCTTCTTGCtctgcctttgagttgttccgtgatcacttctgaataagcagtttgcctttataaaaacttgctgcctgactaaagattaacaggttatagtttaaatttgtaattaattctaccatcttgcaataaagtgacaattgaatgaaacagggtttttcaagttgtataattctctgaaatactcagcttttgtcatatgggtaaaaattaaagatgtcattgaactACTGTCTTGTTTATGAGACCATTCAGTGGTGAACTGTTTCTGGCTGATAGGTTATGAGATATGTAAAGCTTTCTAGTACTCTTAAAATAACTAAATGGAGTATTATATATCAATTCATATCATTGACTTTATTATTTTAGTAGTATGCCTATAGAAAATATTATGGACTCAGAGTGTCATAAAATCACTCTTAAGAATCCATGCAGCAggccaggcacagtggctcacacctgtaatgcctgcactttggaaggccgagacaggcggatcacttgaggtcaggagtttgaaaccagccaggccaacacagtgaaaccctgtctctactaaaaatacaaaaggttagccgggcatggtggcaggcgcctgtaatcccagctactcaggaggctgaggcaggagaattgcttgaacgcaggaggcaaaggttgcagtgagctgagatcacgccactgcactccagcctgggcaacagacctcgactccatctagaaaaaaaaaaaaaaaaaTCCAGCAGACACCtatcaggaacatagaaaataacaagtgttggcaaggaagtggagaagttggaacacttgtgcactgttcgtagaaatatgaaatggtacagccattatggaaaagtgtggtgattcctcataaaattaaaatggaaataccatgatccagcaatcccagtcgacatatatactcaaaaaaattaaaagcagggtcttgaagagatacttgtgttccatggtgatagcagccattgttcacaatagctaaaacatagaagcagcccaatcggccatcagtagatgaatggataagcaaaatgtagtatatccatgcaatggaatattattccacttcaaggaagaaaattctgacactggctacagcatgaatgaaccttgaggacgttatgcagttttacaggatgagttatggagctggatagtggtgatggtggcacattaaggatgtatttaatactgttcttaaatggtacacttaaaaatggtaaattttatgtgtattttacAATCTTTTTTTAAATTGAAGAAAAATCCTGTAGATAAATTAGAAAATTCTTCCCTTCATAGGTTTATCTGCATTTGATTCTCCCATACTTGTACAAGGATTTATTTGTATTCAAATGGACAAATTACGCAATAGGAAATATTTGAAAATATTTATCATGGGTAATTGCTATTTTCATTGACTTCCTAAGATTTTATGTAATAATCATTTGAGTCAATATTGGTAGCTAATGTACTAATCTAATATTGAAATCAGATTGATATCTTTGTTACTTAAAGATAATTTGATTGGATCAGCAGTTATTTCAAattgattaaacaaaaaattataaaaca

Publications

PMID - Link Title