Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name CHCHD2P13
Plot displaying the genomic locations of a retrocopy (in chr8) and its respective parental gene (in chr7). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr8:54191422-54192041  UCSC
Coordinates (T2T) chr8:54568715-54569335  UCSC
Coordinates (hg19) chr8:55103982-55104601  UCSC
Strand -
Parental Sequence NM_001320327.2
Parental seq. overlap 545 bp
Parental seq. overlap (%) 67.6%
Genomic Region Intergenic
Retrocopy Summary CHCHD2P13, located on chr8:54191422-54192041, is a retrocopy of the parental gene CHCHD2. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name CHCHD2
Full Name coiled-coil-helix-coiled-coil-helix domain containing 2
Also known as C7orf17|MIX17B|MNRR1|NS2TP|PARK22
Coordinate chr7:56101573-56106476
Strand -
Gene summary The protein encoded by this gene belongs to a class of eukaryotic CX(9)C proteins characterized by four cysteine residues spaced ten amino acids apart from one another. These residues form disulfide linkages that define a CHCH fold. In response to stress, the protein translocates from the mitochondrial intermembrane space to the nucleus where it binds to a highly conserved 13 nucleotide oxygen responsive element in the promoter of cytochrome oxidase 4I2, a subunit of the terminal enzyme of the electron transport chain. In concert with recombination signal sequence-binding protein J, binding of this protein activates the oxygen responsive element at four percent oxygen. In addition, it has been shown that this protein is a negative regulator of mitochondria-mediated apoptosis. In response to apoptotic stimuli, mitochondrial levels of this protein decrease, allowing BCL2-associated X protein to oligomerize and activate the caspase cascade. Pseudogenes of this gene are found on multiple chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes CHCHD2P6
Bonobo Pan paniscus CHCHD2P7
Gorilla Gorilla gorilla CHCHD2P6
Orangutan Pongo abelii CHCHD2P7
Gibbon Nomascus leucogenys CHCHD2P4
Green monkey Chlorocebus sabaeus CHCHD2P4
Crab-eating macaque Macaca fascicularis CHCHD2P6
Rhesus Macaca mulatta CHCHD2P6
Baboon Papio anubis CHCHD2P6
Golden snub-nosed monkey Rhinopithecus roxellana CHCHD2P6
Marmoset Callithrix jacchus CHCHD2P19
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>CHCHD2P13
CTAGTATGCCACGTGGAAGCCGAAGCCACACCTCCTACAGGGCCCCTCCCACCAGCCAGGCACCTCAGATGAGAGCTACACCCAGGCTAGCACCAGCAGCTCAGCCGCCAGCAGTGGCACCCCCATCTGCAGTTGGCTCTCCTGCTCCTGCACCCCGGCAGCCAAGTCTGATGGCCCAAATGGCAACCACTGCAGCTGGCGTGGCTGTAGGCTCTGCTGTGGGTCACACACTGGGTTATGCCCTCACTGGGAGCTTCAGTGGAGGAAGTAATGGTGAGCCTGCAAAACTTGACATCACTTACCAGCAGCATCAGGGAACCTGGCCAGCACAGCAGCAGCAGCCTTGTTTCCATGAGATCAAACAGTTTTTGGAGTGTGCCCAGAACCAGGGTGACACCAACAAGCTCTGTGGGGCTTTCAAGAGGTTCTCAAACAGTGCAGACTTGCAAACAGATAGGCCTAATCAAGAAGTTCAAATTGGAGAAATGGAAAATCAGCTCTCCTAACCAAGTTAATTCACTATTAAAATAAAATTGATAGTGAAGGTATAAAATATAACCACCAGTTAAACCTCTCGTATGTCATCTATAGCTTCCTTGCTTCAGAATTGAAATGGAAGA
>NM_001320327.2
AGAAGTCGCTTAGCTCTTCGGTGGTTGTCCCACGTCCGGAGGCCTAGCCGTCGCTTACCTAGGATGCCGCGTGGAAGCCGAAGCCGCACCTCCCGCATGGCCCCTCCGGCCAGCCGGGCCCCTCAGATGAGAGCTGCACCCAGGCCAGCACCAGTCGCTCAGCCACCAGCAGCGGCACCCCCATCTGCAGTTGGCTCTTCTGCTGCTGCGCCCCGGCAGCCAGGTCTGATGGCCCAGATGGCAACCACTGCAGCTGGCGTGGCTGTGGGCTCTGCTGTGGGGCACACATTGGGTCACGCCATTACTGGGGGCTTCAGTGGAGGAAGTAATGCTGAGCCTGCGAGGCCTGACATCACTTACCAGGAGCCTCAGGGAACCCAGCCAGCACAGCAGCAGCAGCCTTGCCTCTATGAGATCAAACAGTTTCTGGAGTGTGCCCAGAACCAGGGTGACATCAAGCTCTGTGAGGGTTTCAATGAGGTGCTGAAACAGTGCCGACTTGCAAACGGTAGGATTGGCCTAATGAAGAAGTTCAACCTGGAGAGATGGAAAATCAGCTCTCATAACTAAGTTAATTTAGTATAAAAATAGAATTGATAGTGAGGGTATAAAGTGTAACCATCAGTTAAACCTCTCCTGTCATTCCTGGCTTCCTTGCTTCAGAATTGAAATGGAAGTGGGGGTGTCCCTACTCTGTAGAATCTGGGACTGGGCAAATGTTTGTGTGGCCTCCTTAAACTAGCTGTTATGTTATGATTTTATTCTTTGTGAGTTAATTAGAATAAAGTCATTTTCTTCCAA

Publications

PMID - Link Title