Retrocopy Name | NDUFS5P6 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr8:67849145-67849467 UCSC | |
Coordinates (T2T) | chr8:68275578-68275900 UCSC | |
Coordinates (hg19) | chr8:68761380-68761702 UCSC | |
Strand | + | |
Parental Sequence | NM_004552.3 | |
Parental seq. overlap | 273 bp | |
Parental seq. overlap (%) | 54.8% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | NDUFS5P6, located on chr8:67849145-67849467, is a retrocopy of the parental gene NDUFS5. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | NDUFS5 |
Full Name | NADH:ubiquinone oxidoreductase subunit S5 |
Also known as | CI-15k|CI15K |
Coordinate | chr1:39026350-39034615 |
Strand | + |
Gene summary | This gene is a member of the NADH dehydrogenase (ubiquinone) iron-sulfur protein family. The encoded protein is a subunit of the NADH:ubiquinone oxidoreductase (complex I), the first enzyme complex in the electron transport chain located in the inner mitochondrial membrane. Alternative splicing results in multiple transcript variants and pseudogenes have been identified on chromosomes 1, 4 and 17. [provided by RefSeq, May 2010] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | NDUFS5P5 |
![]() |
Gorilla | Gorilla gorilla | NDUFS5P4 |
![]() |
Gibbon | Nomascus leucogenys | NDUFS5P5 |
![]() |
Crab-eating macaque | Macaca fascicularis | NDUFS5P4 |
![]() |
Rhesus | Macaca mulatta | NDUFS5P3 |
![]() |
Baboon | Papio anubis | NDUFS5P5 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | NDUFS5P6 |
![]() |
Bonobo | Pan paniscus | Without Homology |
![]() |
Orangutan | Pongo abelii | Without Homology |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>NDUFS5P6 |
GAAAAAAATTGATAGAATGTGAACATGGAATAGGTAGTATCTGGGAAGAGAAAGAGTGCAAGACAGAATCTGATGATTTCATAGAGTGCATGCTTCAGCAGAAAACAATGGGACTTGTGAGAGCCATCAAGAAGTTGCGGGATAAGCTAATAATGGAAGGGAAGTACACCCTTCCACCTCACTGCTTGGGTAAGGGGGATCCTAGGCCCTGAGCAGAGCCACTGCTGATGTCTGGAGGCTAAATTTCATGTTCTCTATTCTCCACTGGAAAGACTGTTTAATGAAAACTTATTTGTCAAAGTGTGTAAAAGTAAAGGTTTGCT |
>NM_004552.3 |
AGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAAGGGCACGAGCATCGGGTAGCCATGCCTTTCTTGGACATCCAGAAAAGGTTCGGCCTTAACATAGATCGATGGTTGACAATCCAGAGTGGTGAACAGCCCTACAAGATGGCTGGTCGATGCCATGCTTTTGAAAAAGAATGGATAGAATGTGCACATGGAATCGGTTATACTCGGGCAGAGAAAGAGTGCAAGATAGAATATGATGATTTCGTAGAGTGTTTGCTTCGGCAGAAAACGATGAGACGTGCAGGTACCATCAGGAAGCAGCGGGATAAGCTGATAAAGGAAGGAAAGTACACCCCTCCACCTCACCACATTGGCAAGGGGGAGCCTCGGCCCTGAACAGAGCAGCTGCTGATGTCTGGAGGCTGATTTTCCTGTTCTCTGTTCTCCACTGGAAAGGTTGTTTACGACAAACCTCCTTGTCAAAGTGTGTAAAAATAAAGGATTGCTCCATCCTA |
PMID - Link | Title |
---|