Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name ATP5MFP8
Plot displaying the genomic locations of a retrocopy (in chr9) and its respective parental gene (in chr7). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr9:108836325-108836602  UCSC
Coordinates (T2T) chr9:121005478-121005755  UCSC
Coordinates (hg19) chr9:111598605-111598882  UCSC
Strand +
Parental Sequence NM_001003713.4
Parental seq. overlap 236 bp
Parental seq. overlap (%) 55.3%
Genomic Region Intergenic
Retrocopy Summary ATP5MFP8, located on chr9:108836325-108836602, is a retrocopy of the parental gene ATP5MF. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name ATP5MF
Full Name ATP synthase membrane subunit f
Also known as ATP5J2|ATP5JL
Coordinate chr7:99458195-99466167
Strand -
Gene summary Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The catalytic portion of mitochondrial ATP synthase consists of five different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and single representatives of the gamma, delta, and epsilon subunits. The proton channel likely has nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the f subunit of the Fo complex. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. This gene has multiple pseudogenes. Naturally occurring read-through transcription also exists between this gene and the downstream pentatricopeptide repeat domain 1 (PTCD1) gene. [provided by RefSeq, Nov 2010]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes ATP5MFP4
Bonobo Pan paniscus ATP5MFP4
Gorilla Gorilla gorilla ATP5MFP5
Orangutan Pongo abelii ATP5MFP3
Gibbon Nomascus leucogenys ATP5MFP1
Green monkey Chlorocebus sabaeus ATP5J2P6
Crab-eating macaque Macaca fascicularis ATP5J2P11
Rhesus Macaca mulatta ATP5MFP10
Baboon Papio anubis ATP5MFP6
Golden snub-nosed monkey Rhinopithecus roxellana ATP5MFP8
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>ATP5MFP8
CCTCCAAGATGGTATCAGTTATACCAGTGAAGGAGAAGAAACTCCTGGATGTCAAACTAGGGGAGCTGCCAAGCTGGATACTGATGCAAGATTTCACCCCTAGTGGCATTGCTGGAGCATTTCAAAGAGGTTTCTACTGGTACTACAACAAGTACATCGACGTGAAGAAAGGGTGTCTCAGGGGGTTCCACGGTACTGGCAGCTTACATGCTCTTCAGCTACTGCCTTTCCTACAAGGAGCTCAAGCATGAGCAGCTATGCAAGTACCACTGAAGAGG
>NM_001003713.4
GGCACAGCGGACACCAGGACTCCAAAATGGCGTCAGTTGTACCAGTGAAGGACAAGAAACTTCTGGAGGTCAAACTGGGGGAGCTGCCAAGCTGGATCTTGATGCGGGACTTCAGTCCTAGTGGCATTTTCGGAGCGTTTCAAAGAGGTTACTACCGGTACTACAACAAGTACATCAATGTGAAGAAGGGGAGCATCTCGGGGATTACCATGGTGCTGGCATGCTACGTGCTCTTTAGCTACTCCTTTTCCTACAAGCATCTCAAGCACGAGCGGCTCCGCAAATACCACTGAAGAGGACACACTCTGCACCCCCCCACCCCACGACCTTGGCCCGAGCCCCTCCGTGAGGAACACAATCTCAATCGTTGCTGAATCCTTTCATATCCTAATAGGAATTAACCTCCAAATAAAACATGACTGGTA

Publications

PMID - Link Title