 
    | Retrocopy Name | HSPE1P28 |  | 
| Species | Homo sapiens | |
| Coordinates (hg38) | chr9:112281169-112281337 UCSC | |
| Coordinates (T2T) | chr9:124452316-124452484 UCSC | |
| Coordinates (hg19) | chr9:115043449-115043617 UCSC | |
| Strand | - | |
| Parental Sequence | NM_002157.3 | |
| Parental seq. overlap | 146 bp | |
| Parental seq. overlap (%) | 26.2% | |
| Genomic Region | Intragenic (PTBP3) | |
| Retrocopy Summary | HSPE1P28, located on chr9:112281169-112281337, is a retrocopy of the parental gene HSPE1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. | 
| Gene Name | HSPE1 | 
| Full Name | heat shock protein family E (Hsp10) member 1 | 
| Also known as | CPN10|EPF|GROES|HSP10 | 
| Coordinate | chr2:197500379-197503449 | 
| Strand | + | 
| Gene summary | This gene encodes a major heat shock protein which functions as a chaperonin. Its structure consists of a heptameric ring which binds to another heat shock protein in order to form a symmetric, functional heterodimer which enhances protein folding in an ATP-dependent manner. This gene and its co-chaperonin, HSPD1, are arranged in a head-to-head orientation on chromosome 2. Naturally occurring read-through transcription occurs between this locus and the neighboring locus MOBKL3.[provided by RefSeq, Feb 2011] | 
| Species | Scientific Name | Retrocopy | |
|  | Gorilla | Gorilla gorilla | LOC101151505P16 | 
|  | Orangutan | Pongo abelii | HSPE1P12 | 
|  | Gibbon | Nomascus leucogenys | LOC100605912P7 | 
|  | Green monkey | Chlorocebus sabaeus | LOC103217585P16 | 
|  | Crab-eating macaque | Macaca fascicularis | LOC102147033P23 | 
|  | Rhesus | Macaca mulatta | HSPE1P19 | 
|  | Baboon | Papio anubis | LOC101019904P19 | 
|  | Golden snub-nosed monkey | Rhinopithecus roxellana | LOC104676747P21 | 
|  | Marmoset | Callithrix jacchus | LOC100385103P2 | 
|  | Mouse lemur | Microcebus murinus | HSPE1P15 | 
|  | Chimpanzee | Pan troglodytes | Without Homology | 
|  | Bonobo | Pan paniscus | Without Homology | 
|  | Mouse | Mus musculus | Without Homology | 
|  | Rat | Rattus norvegicus | Without Homology | 
|  | Chinese hamster | Cricetulus griseus | Without Homology | 
|  | Rabbit | Oryctolagus cuniculus | Without Homology | 
|  | Pig | Sus scrofa | Without Homology | 
|  | Cow | Bos taurus | Without Homology | 
|  | Sheep | Ovis aries | Without Homology | 
|  | Dolphin | Tursiops truncatus | Without Homology | 
|  | Horse | Equus caballus | Without Homology | 
|  | Dog | Canis familiaris | Without Homology | 
|  | Panda | Ailuropoda melanoleuca | Without Homology | 
|  | Cat | Felis catus | Without Homology | 
|  | Pale spear-nosed bat | Phyllostomus discolor | Without Homology | 
|  | Velvety free-tailed bat | Molossus molossus | Without Homology | 
|  | Greater mouse-eared bat | Myotis myotis | Without Homology | 
|  | Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology | 
|  | Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology | 
|  | Egyptian rousette | Rousettus aegyptiacus | Without Homology | 
|  | Sloth | Choloepus didactylus | Without Homology | 
|  | Tasmanian Devil | Sarcophilus harrisii | Without Homology | 
|  | Opossum | Monodelphis domestica | Without Homology | 
|  | Platypus | Ornithorhynchus anatinus | Without Homology | 
|  | Chicken | Gallus gallus | Without Homology | 
|  | Turkey | Meleagris gallopavo | Without Homology | 
|  | Zebra Finch | Taeniopygia guttata | Without Homology | 
|  | Budgerigar | Melopsittacus undulatus | Without Homology | 
|  | Painted Turtle | Chrysemys picta | Without Homology | 
|  | Lizard | Anolis Carolinensis | Without Homology | 
|  | Frog | Xenopus tropicalis | Without Homology | 
|  | Zebrafish | Danio rerio | Without Homology | 
|  | Drosophila | Drosophila melanogaster | Without Homology | 
| >HSPE1P28 | 
| AGGCATTATGCTTACAGAAAATTCTCAAGGAAAAGTATTGTAAGCAATAGTTGGTAGCTGTTGGATTGGGCTCTGAAGGAAAGAATGGAGAGATTCAGCCAGTTAGCATGAAAGTTGGAGATAAAGTTGTACTCACAAAATGTGGAGGACTAAAGTAATTCTAAATGAT | 
| >NM_002157.3 | 
| GCGAGTCTCTTTGCGGCGCTACACTAGAGCAGAGTACGAGTCTGAGGCGGAGGGAGTAATGGCAGGACAAGCGTTTAGAAAGTTTCTTCCACTCTTTGACCGAGTATTGGTTGAAAGGAGTGCTGCTGAAACTGTAACCAAAGGAGGCATTATGCTTCCAGAAAAATCTCAAGGAAAAGTATTGCAAGCAACAGTAGTCGCTGTTGGATCGGGTTCTAAAGGAAAGGGTGGAGAGATTCAACCAGTTAGCGTGAAAGTTGGAGATAAAGTTCTTCTCCCAGAATATGGAGGCACCAAAGTAGTTCTAGATGACAAGGATTATTTCCTATTTAGAGATGGTGACATTCTTGGAAAGTACGTAGACTGAAATAAGTCACTATTGAAATGGCATCAACATGATGCTGCCCATTCCACTGAAGTTCTGAAATCTTTCGTCATGTAAATAATTTCCATATTTCTCTTTTATAATAAACTAATGATAACTAATGACATCCAGTGTCTCCAAAATTGTTTCCTTGTACTGATATAAACACTTCCAAATAAAAATATGTAAATGA | 
| PMID - Link | Title | 
|---|---|
| 10763410 | Mapping and characterization of the eukaryotic early pregnancy factor/chaperonin 10 gene family. |