Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name HSPE1P28
Wait
Plot displaying the genomic locations of a retrocopy (in chr9) and its respective parental gene (in chr2). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr9:112281169-112281337  UCSC
Coordinates (T2T) chr9:124452316-124452484  UCSC
Coordinates (hg19) chr9:115043449-115043617  UCSC
Strand -
Parental Sequence NM_002157.3
Parental seq. overlap 146 bp
Parental seq. overlap (%) 26.2%
Genomic Region Intragenic (PTBP3)
Retrocopy Summary HSPE1P28, located on chr9:112281169-112281337, is a retrocopy of the parental gene HSPE1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name HSPE1
Full Name heat shock protein family E (Hsp10) member 1
Also known as CPN10|EPF|GROES|HSP10
Coordinate chr2:197500379-197503449
Strand +
Gene summary This gene encodes a major heat shock protein which functions as a chaperonin. Its structure consists of a heptameric ring which binds to another heat shock protein in order to form a symmetric, functional heterodimer which enhances protein folding in an ATP-dependent manner. This gene and its co-chaperonin, HSPD1, are arranged in a head-to-head orientation on chromosome 2. Naturally occurring read-through transcription occurs between this locus and the neighboring locus MOBKL3.[provided by RefSeq, Feb 2011]

Homology

Species Scientific Name Retrocopy
Gorilla Gorilla gorilla LOC101151505P16
Orangutan Pongo abelii HSPE1P12
Gibbon Nomascus leucogenys LOC100605912P7
Green monkey Chlorocebus sabaeus LOC103217585P16
Crab-eating macaque Macaca fascicularis LOC102147033P23
Rhesus Macaca mulatta HSPE1P19
Baboon Papio anubis LOC101019904P19
Golden snub-nosed monkey Rhinopithecus roxellana LOC104676747P21
Marmoset Callithrix jacchus LOC100385103P2
Mouse lemur Microcebus murinus HSPE1P15
Chimpanzee Pan troglodytes Without Homology
Bonobo Pan paniscus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Adipose SubcutaneousMuscle SkeletalArtery TibialArtery CoronaryHeart Atrial AppendageAdipose VisceralUterusVaginaBreast Mammary TissueSkin Not Sun ExposedMinor Salivary GlandBrain CortexAdrenal GlandThyroidLungSpleenPancreasEsophagus MuscularisEsophagus MucosaEsophagus Gastroesophageal JunctionStomachColon SigmoidSmall Intestine Terminal IleumColon TransverseProstateTestisNerve TibialSkin Sun ExposedHeart Left VentricleBrain CerebellumWhole BloodArtery AortaPituitaryBrain Frontal CortexBrain CaudateBrain Nucleus AccumbensBrain PutamenBrain HypothalamusBrain Spinal CordBrain HippocampusBrain Anterior Cingulate CortexOvaryBrain Cerebellar HemisphereLiverBrain Substantia NigraKidney CortexBrain AmygdalaCervix EctocervixFallopian TubeCervix EndocervixBladderKidney Medulla00.20.4
log10(TPM+1)

Massive Mining of Publicly Available RNA-seq Data from Human and Mouse - (ARCHS4)

AdiposeBone MarrowBreast Mammary TissueBrain CerebellumColonColon Colonic MucosaEsophagusHeartHeart VentricleKidneyLiverBrain MidbrainOvaryPancreasBrain PonsKidney CortexEye RetinaMuscle SkeletalSkinSmall IntestineBrain Spinal CordSpleenTestisThymusTracheaHeart ValveMuscle Smooth01234
log10(TPM+1)

Related Sequence

>HSPE1P28
AGGCATTATGCTTACAGAAAATTCTCAAGGAAAAGTATTGTAAGCAATAGTTGGTAGCTGTTGGATTGGGCTCTGAAGGAAAGAATGGAGAGATTCAGCCAGTTAGCATGAAAGTTGGAGATAAAGTTGTACTCACAAAATGTGGAGGACTAAAGTAATTCTAAATGAT
>NM_002157.3
GCGAGTCTCTTTGCGGCGCTACACTAGAGCAGAGTACGAGTCTGAGGCGGAGGGAGTAATGGCAGGACAAGCGTTTAGAAAGTTTCTTCCACTCTTTGACCGAGTATTGGTTGAAAGGAGTGCTGCTGAAACTGTAACCAAAGGAGGCATTATGCTTCCAGAAAAATCTCAAGGAAAAGTATTGCAAGCAACAGTAGTCGCTGTTGGATCGGGTTCTAAAGGAAAGGGTGGAGAGATTCAACCAGTTAGCGTGAAAGTTGGAGATAAAGTTCTTCTCCCAGAATATGGAGGCACCAAAGTAGTTCTAGATGACAAGGATTATTTCCTATTTAGAGATGGTGACATTCTTGGAAAGTACGTAGACTGAAATAAGTCACTATTGAAATGGCATCAACATGATGCTGCCCATTCCACTGAAGTTCTGAAATCTTTCGTCATGTAAATAATTTCCATATTTCTCTTTTATAATAAACTAATGATAACTAATGACATCCAGTGTCTCCAAAATTGTTTCCTTGTACTGATATAAACACTTCCAAATAAAAATATGTAAATGA

Publications

PMID - Link Title
10763410Mapping and characterization of the eukaryotic early pregnancy factor/chaperonin 10 gene family.