Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name NDUFB3P7
Wait
Plot displaying the genomic locations of a retrocopy (in chr9) and its respective parental gene (in chr2). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr9:125178501-125178816  UCSC
Coordinates (T2T) chr9:137376838-137377153  UCSC
Coordinates (hg19) chr9:127940780-127941095  UCSC
Strand -
Parental Sequence NM_001257102.2
Parental seq. overlap 273 bp
Parental seq. overlap (%) 52.9%
Genomic Region Intragenic (PPP6C)
Retrocopy Summary NDUFB3P7, located on chr9:125178501-125178816, is a retrocopy of the parental gene NDUFB3. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name NDUFB3
Full Name NADH:ubiquinone oxidoreductase subunit B3
Also known as B12|CI-B12|MC1DN25
Coordinate chr2:201071784-201085750
Strand +
Gene summary This gene encodes an accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) which is the first enzyme in the electron transport chain of mitochondria. This protein localizes to the inner membrane of the mitochondrion as a single-pass membrane protein. Mutations in this gene contribute to mitochondrial complex 1 deficiency. Alternative splicing results in multiple transcript variants encoding the same protein. Humans have multiple pseudogenes of this gene. [provided by RefSeq, Mar 2012]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes NDUFB3P2
Bonobo Pan paniscus NDUFB3P2
Gorilla Gorilla gorilla NDUFB3P2
Orangutan Pongo abelii NDUFB3P2
Gibbon Nomascus leucogenys NDUFB3P2
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

This retrocopy transcript is not present in the ARCHS4 database for expression quantificationThis retrocopy transcript is not present in the GTEx database for expression quantification.

Related Sequence

>NDUFB3P7
AGAAACTGTCTAGAAGAAGCTGGCTGCAGGAGGGCTAAGGGATTTATTGGGCCTCAGTGAAGCTTGGTGATACGTGGGTGGCTTTGCAGAAATGTTTCCTTTGTTGGTGCATTATTACAAAGATTCAAATGGGGATTTGCTGCATTTGTGGTAGCTGTAGGAGCTGAATATTACTTGGAGTCCCAGAATAAAGATAAACATCACTGAAGATAATACCTGGAAGTATCATAGTGGTTTCTTAACTAAGATTTCCTCACTGTAGCCTACTTGCCTGGTTTGTCCCTTAAAGAATATTAGTAAGAT
>NM_001257102.2
CGTTTCCGGTTGGCTCCGGTTGCAGAGTTGAGTGTCCTGAGAGGTCAGATTGCTGTCAGGCAGAAGAACAGCATCACTAAAAacatggcccatgaacatggacatgagcatggacatCATAAAATGGAACTTCCAGATTATAGACAATGGAAGATAGAAGGGACACCATTAGAAACTATCCAGAAGAAGCTGGCTGCAAAAGGGCTAAGGGATCCATGGGGCCGCAATGAAGCTTGGAGATACATGGGTGGCTTTGCAAAGAGTGTTTCCTTTTCTGATGTATTCTTTAAAGGATTCAAATGGGGATTTGCTGCATTTGTGGTAGCTGTAGGAGCTGAATATTACCTGGAGTCCCTGAATAAAGATAAGAAGCATCACTGAAGATAATACCTGGAAGCATCATAGTGGTTTCTTAACTCTCCAAAATAAGATTTCTTCTCTGTAGCCTACTTGTCTGGTTTATCCCTTACAGAATATTAGTAAGATTTAATCAATTAAAATATATATATATGCCAA

Publications

PMID - Link Title
No publications available for this retrocopy