| Retrocopy Name | NDUFB3P7 |
![]() |
| Species | Homo sapiens | |
| Coordinates (hg38) | chr9:125178501-125178816 UCSC | |
| Coordinates (T2T) | chr9:137376838-137377153 UCSC | |
| Coordinates (hg19) | chr9:127940780-127941095 UCSC | |
| Strand | - | |
| Parental Sequence | NM_001257102.2 | |
| Parental seq. overlap | 273 bp | |
| Parental seq. overlap (%) | 52.9% | |
| Genomic Region |
Intragenic (PPP6C) |
|
| Retrocopy Summary | NDUFB3P7, located on chr9:125178501-125178816, is a retrocopy of the parental gene NDUFB3. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | NDUFB3 |
| Full Name | NADH:ubiquinone oxidoreductase subunit B3 |
| Also known as | B12|CI-B12|MC1DN25 |
| Coordinate | chr2:201071784-201085750 |
| Strand | + |
| Gene summary | This gene encodes an accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) which is the first enzyme in the electron transport chain of mitochondria. This protein localizes to the inner membrane of the mitochondrion as a single-pass membrane protein. Mutations in this gene contribute to mitochondrial complex 1 deficiency. Alternative splicing results in multiple transcript variants encoding the same protein. Humans have multiple pseudogenes of this gene. [provided by RefSeq, Mar 2012] |
| Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | NDUFB3P2 |
![]() |
Bonobo | Pan paniscus | NDUFB3P2 |
![]() |
Gorilla | Gorilla gorilla | NDUFB3P2 |
![]() |
Orangutan | Pongo abelii | NDUFB3P2 |
![]() |
Gibbon | Nomascus leucogenys | NDUFB3P2 |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >NDUFB3P7 |
| AGAAACTGTCTAGAAGAAGCTGGCTGCAGGAGGGCTAAGGGATTTATTGGGCCTCAGTGAAGCTTGGTGATACGTGGGTGGCTTTGCAGAAATGTTTCCTTTGTTGGTGCATTATTACAAAGATTCAAATGGGGATTTGCTGCATTTGTGGTAGCTGTAGGAGCTGAATATTACTTGGAGTCCCAGAATAAAGATAAACATCACTGAAGATAATACCTGGAAGTATCATAGTGGTTTCTTAACTAAGATTTCCTCACTGTAGCCTACTTGCCTGGTTTGTCCCTTAAAGAATATTAGTAAGAT |
| >NM_001257102.2 |
| CGTTTCCGGTTGGCTCCGGTTGCAGAGTTGAGTGTCCTGAGAGGTCAGATTGCTGTCAGGCAGAAGAACAGCATCACTAAAAacatggcccatgaacatggacatgagcatggacatCATAAAATGGAACTTCCAGATTATAGACAATGGAAGATAGAAGGGACACCATTAGAAACTATCCAGAAGAAGCTGGCTGCAAAAGGGCTAAGGGATCCATGGGGCCGCAATGAAGCTTGGAGATACATGGGTGGCTTTGCAAAGAGTGTTTCCTTTTCTGATGTATTCTTTAAAGGATTCAAATGGGGATTTGCTGCATTTGTGGTAGCTGTAGGAGCTGAATATTACCTGGAGTCCCTGAATAAAGATAAGAAGCATCACTGAAGATAATACCTGGAAGCATCATAGTGGTTTCTTAACTCTCCAAAATAAGATTTCTTCTCTGTAGCCTACTTGTCTGGTTTATCCCTTACAGAATATTAGTAAGATTTAATCAATTAAAATATATATATATGCCAA |
| PMID - Link | Title |
|---|---|
| No publications available for this retrocopy | |