Retrocopy Name | SMN2P2 |
![]() |
Species | Homo sapiens | |
Coordinates (hg38) | chr9:20331519-20331972 UCSC | |
Coordinates (T2T) | chr9:20345304-20345757 UCSC | |
Coordinates (hg19) | chr9:20331517-20331970 UCSC | |
Strand | + | |
Parental Sequence | NM_022877.2 | |
Parental seq. overlap | 404 bp | |
Parental seq. overlap (%) | 27.3% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | SMN2P2, located on chr9:20331519-20331972, is a retrocopy of the parental gene SMN2. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | SMN2 |
Full Name | survival of motor neuron 2, centromeric |
Also known as | BCD541|C-BCD541|GEMIN1|SMNC|TDRD16B |
Coordinate | chr5:70049523-70077595 |
Strand | + |
Gene summary | This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. The telomeric and centromeric copies of this gene are nearly identical and encode the same protein. While mutations in the telomeric copy are associated with spinal muscular atrophy, mutations in this gene, the centromeric copy, do not lead to disease. This gene may be a modifier of disease caused by mutation in the telomeric copy. The critical sequence difference between the two genes is a single nucleotide in exon 7, which is thought to be an exon splice enhancer. Note that the nine exons of both the telomeric and centromeric copies are designated historically as exon 1, 2a, 2b, and 3-8. It is thought that gene conversion events may involve the two genes, leading to varying copy numbers of each gene. The full length protein encoded by this gene localizes to both the cytoplasm and the nucleus. Within the nucleus, the protein localizes to subnuclear bodies called gems which are found near coiled bodies containing high concentrations of small ribonucleoproteins (snRNPs). This protein forms heteromeric complexes with proteins such as SIP1 and GEMIN4, and also interacts with several proteins known to be involved in the biogenesis of snRNPs, such as hnRNP U protein and the small nucleolar RNA binding protein. Four transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Sep 2008] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | LOC461829P2 |
![]() |
Bonobo | Pan paniscus | LOC100984482P2 |
![]() |
Gorilla | Gorilla gorilla | LOC101148291P2 |
![]() |
Orangutan | Pongo abelii | SMN1P2 |
![]() |
Gibbon | Nomascus leucogenys | SMN1P1 |
![]() |
Green monkey | Chlorocebus sabaeus | LOC103222822P2 |
![]() |
Crab-eating macaque | Macaca fascicularis | SMN1P3 |
![]() |
Rhesus | Macaca mulatta | SMN1P3 |
![]() |
Baboon | Papio anubis | SMN1P2 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | LOC104675640P2 |
![]() |
Marmoset | Callithrix jacchus | SMN2P1 |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>SMN2P2 |
TAGGCCAGAGTGACGTTTCTGACATTTGGGATGCTACAGCACTGATAGAAGTGGATGATAAAGCTGTGGCTTCATTTAAACAGGCTCTAAAGAATGATGACATTTGTGAAACCTCAGATAAACCAAAAAGCATGCCTAATAGAAAACCTGCTAAGAAGCATAAAGGCCAAAAAAAGAATACTGTAACTTTCTTGAAGTAGTGGAAAGTTGGGGACAAATGTCCTGCCATTTGGTCAGAAGACAGCTGCATTTACTCTGCTACCATTGCTTCAGTTGATATGAAGAGAGAAAGCTGTGTTGTGATTTACACTGGATATGGAAATAGAGAGGAGCAAATCTGTCTGATCTACTTTCTTCAACCTCTGTAGCTAATAATATAGGACAGAATGCTCAAAAGAATGAAAATGAAAGTCAAGATTCAATGGATGAAAGTGAGAACTCCAGGTCCTGGAAA |
>NM_022877.2 |
CCACAAATGTGGGAGGGCGATAACCACTCGTAGAAAGCGTGAGAAGTTACTACAAGCGGTCCTCCCGGCCACCGTACTGTTCCGCTCCCAGAAGCCCCGGGCGGCGGAAGTCGTCACTCTTAAGAAGGGACGGGGCCCCACGCTGCGCACCCGCGGGTTTGCTATGGCGATGAGCAGCGGCGGCAGTGGTGGCGGCGTCCCGGAGCAGGAGGATTCCGTGCTGTTCCGGCGCGGCACAGGCCAGAGCGATGATTCTGACATTTGGGATGATACAGCACTGATAAAAGCATATGATAAAGCTGTGGCTTCATTTAAGCATGCTCTAAAGAATGGTGACATTTGTGAAACTTCGGGTAAACCAAAAACCACACCTAAAAGAAAACCTGCTAAGAAGAATAAAAGCCAAAAGAAGAATACTGCAGCTTCCTTACAACAGTGGAAAGTTGGGGACAAATGTTCTGCCATTTGGTCAGAAGACGGTTGCATTTACCCAGCTACCATTGCTTCAATTGATTTTAAGAGAGAAACCTGTGTTGTGGTTTACACTGGATATGGAAATAGAGAGGAGCAAAATCTGTCCGATCTACTTTCCCCAATCTGTGAAGTAGCTAATAATATAGAACAGAATGCTCAAGAGAATGAAAATGAAAGCCAAGTTTCAACAGATGAAAGTGAGAACTCCAGGTCTCCTGGAAATAAATCAGATAACATCAAGCCCAAATCTGCTCCATGGAACTCTTTTCTCCCTCCACCACCCCCCATGCCAGGGCCAAGACTGGGACCAGGAAAGATAATTCCCCCACCACCTCCCATATGTCCAGATTCTCTTGATGATGCTGATGCTTTGGGAAGTATGTTAATTTCATGGTACATGAGTGGCTATCATACTGGCTATTATATGgaaatgctggcatagagcagcactaaatgacaccactaaagaaacgatcagacagatctggaatgtgaagcgttatagaagataactggcctcatttcttcaaaatatcaagtgttgggaaagaaaaaaggaagtggaatgggtaactcttcttgattaaaagttatgtaataaccaaatgcaatgtgaaatattttactggactctattttgaaaaaccatctgtaaaagactgaggtgggggtgggaggccagcacggtggtgaggcagttgagaaaatttgaatgtggattagattttgaatgatattggataattattggtaattttatgagctgtgagaagggtgttgtagtttataaaagactgtcttaatttgcatacttaagcatttaggaatgaagtgttagagtgtcttaaaatgtttcaaatggtttaacaaaatgtatgtgaggcgtatgtggcaaaatgttacagaatctaactggtggacatggctgttcattgtactgtttttttctatcttctatatgtttaaaagtatataataaaaaTATTTAATTTTTTTTTAAATTA |
PMID - Link | Title |
---|