Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name SMN2P2
Plot displaying the genomic locations of a retrocopy (in chr9) and its respective parental gene (in chr5). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr9:20331519-20331972  UCSC
Coordinates (T2T) chr9:20345304-20345757  UCSC
Coordinates (hg19) chr9:20331517-20331970  UCSC
Strand +
Parental Sequence NM_022877.2
Parental seq. overlap 404 bp
Parental seq. overlap (%) 27.3%
Genomic Region Intergenic
Retrocopy Summary SMN2P2, located on chr9:20331519-20331972, is a retrocopy of the parental gene SMN2. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name SMN2
Full Name survival of motor neuron 2, centromeric
Also known as BCD541|C-BCD541|GEMIN1|SMNC|TDRD16B
Coordinate chr5:70049523-70077595
Strand +
Gene summary This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. The telomeric and centromeric copies of this gene are nearly identical and encode the same protein. While mutations in the telomeric copy are associated with spinal muscular atrophy, mutations in this gene, the centromeric copy, do not lead to disease. This gene may be a modifier of disease caused by mutation in the telomeric copy. The critical sequence difference between the two genes is a single nucleotide in exon 7, which is thought to be an exon splice enhancer. Note that the nine exons of both the telomeric and centromeric copies are designated historically as exon 1, 2a, 2b, and 3-8. It is thought that gene conversion events may involve the two genes, leading to varying copy numbers of each gene. The full length protein encoded by this gene localizes to both the cytoplasm and the nucleus. Within the nucleus, the protein localizes to subnuclear bodies called gems which are found near coiled bodies containing high concentrations of small ribonucleoproteins (snRNPs). This protein forms heteromeric complexes with proteins such as SIP1 and GEMIN4, and also interacts with several proteins known to be involved in the biogenesis of snRNPs, such as hnRNP U protein and the small nucleolar RNA binding protein. Four transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Sep 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes LOC461829P2
Bonobo Pan paniscus LOC100984482P2
Gorilla Gorilla gorilla LOC101148291P2
Orangutan Pongo abelii SMN1P2
Gibbon Nomascus leucogenys SMN1P1
Green monkey Chlorocebus sabaeus LOC103222822P2
Crab-eating macaque Macaca fascicularis SMN1P3
Rhesus Macaca mulatta SMN1P3
Baboon Papio anubis SMN1P2
Golden snub-nosed monkey Rhinopithecus roxellana LOC104675640P2
Marmoset Callithrix jacchus SMN2P1
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>SMN2P2
TAGGCCAGAGTGACGTTTCTGACATTTGGGATGCTACAGCACTGATAGAAGTGGATGATAAAGCTGTGGCTTCATTTAAACAGGCTCTAAAGAATGATGACATTTGTGAAACCTCAGATAAACCAAAAAGCATGCCTAATAGAAAACCTGCTAAGAAGCATAAAGGCCAAAAAAAGAATACTGTAACTTTCTTGAAGTAGTGGAAAGTTGGGGACAAATGTCCTGCCATTTGGTCAGAAGACAGCTGCATTTACTCTGCTACCATTGCTTCAGTTGATATGAAGAGAGAAAGCTGTGTTGTGATTTACACTGGATATGGAAATAGAGAGGAGCAAATCTGTCTGATCTACTTTCTTCAACCTCTGTAGCTAATAATATAGGACAGAATGCTCAAAAGAATGAAAATGAAAGTCAAGATTCAATGGATGAAAGTGAGAACTCCAGGTCCTGGAAA
>NM_022877.2
CCACAAATGTGGGAGGGCGATAACCACTCGTAGAAAGCGTGAGAAGTTACTACAAGCGGTCCTCCCGGCCACCGTACTGTTCCGCTCCCAGAAGCCCCGGGCGGCGGAAGTCGTCACTCTTAAGAAGGGACGGGGCCCCACGCTGCGCACCCGCGGGTTTGCTATGGCGATGAGCAGCGGCGGCAGTGGTGGCGGCGTCCCGGAGCAGGAGGATTCCGTGCTGTTCCGGCGCGGCACAGGCCAGAGCGATGATTCTGACATTTGGGATGATACAGCACTGATAAAAGCATATGATAAAGCTGTGGCTTCATTTAAGCATGCTCTAAAGAATGGTGACATTTGTGAAACTTCGGGTAAACCAAAAACCACACCTAAAAGAAAACCTGCTAAGAAGAATAAAAGCCAAAAGAAGAATACTGCAGCTTCCTTACAACAGTGGAAAGTTGGGGACAAATGTTCTGCCATTTGGTCAGAAGACGGTTGCATTTACCCAGCTACCATTGCTTCAATTGATTTTAAGAGAGAAACCTGTGTTGTGGTTTACACTGGATATGGAAATAGAGAGGAGCAAAATCTGTCCGATCTACTTTCCCCAATCTGTGAAGTAGCTAATAATATAGAACAGAATGCTCAAGAGAATGAAAATGAAAGCCAAGTTTCAACAGATGAAAGTGAGAACTCCAGGTCTCCTGGAAATAAATCAGATAACATCAAGCCCAAATCTGCTCCATGGAACTCTTTTCTCCCTCCACCACCCCCCATGCCAGGGCCAAGACTGGGACCAGGAAAGATAATTCCCCCACCACCTCCCATATGTCCAGATTCTCTTGATGATGCTGATGCTTTGGGAAGTATGTTAATTTCATGGTACATGAGTGGCTATCATACTGGCTATTATATGgaaatgctggcatagagcagcactaaatgacaccactaaagaaacgatcagacagatctggaatgtgaagcgttatagaagataactggcctcatttcttcaaaatatcaagtgttgggaaagaaaaaaggaagtggaatgggtaactcttcttgattaaaagttatgtaataaccaaatgcaatgtgaaatattttactggactctattttgaaaaaccatctgtaaaagactgaggtgggggtgggaggccagcacggtggtgaggcagttgagaaaatttgaatgtggattagattttgaatgatattggataattattggtaattttatgagctgtgagaagggtgttgtagtttataaaagactgtcttaatttgcatacttaagcatttaggaatgaagtgttagagtgtcttaaaatgtttcaaatggtttaacaaaatgtatgtgaggcgtatgtggcaaaatgttacagaatctaactggtggacatggctgttcattgtactgtttttttctatcttctatatgtttaaaagtatataataaaaaTATTTAATTTTTTTTTAAATTA

Publications

PMID - Link Title