Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name UBA52P6
Plot displaying the genomic locations of a retrocopy (in chr9) and its respective parental gene (in chr19). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr9:22012114-22012622  UCSC
Coordinates (T2T) chr9:22026491-22026999  UCSC
Coordinates (hg19) chr9:22012113-22012621  UCSC
Strand +
Parental Sequence XM_005260053.3
Parental seq. overlap 459 bp
Parental seq. overlap (%) 69.9%
Genomic Region Intergenic
Retrocopy Summary UBA52P6, located on chr9:22012114-22012622, is a retrocopy of the parental gene UBA52. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name UBA52
Full Name ubiquitin A-52 residue ribosomal protein fusion product 1
Also known as CEP52|HUBCEP52|L40|RPL40
Coordinate chr19:18563766-18577550
Strand +
Gene summary Ubiquitin is a highly conserved nuclear and cytoplasmic protein that has a major role in targeting cellular proteins for degradation by the 26S proteosome. It is also involved in the maintenance of chromatin structure, the regulation of gene expression, and the stress response. Ubiquitin is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin moiety fused to an unrelated protein. This gene encodes a fusion protein consisting of ubiquitin at the N terminus and ribosomal protein L40 at the C terminus, a C-terminal extension protein (CEP). Multiple processed pseudogenes derived from this gene are present in the genome. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes UBA52P5
Bonobo Pan paniscus UBA52P7
Gorilla Gorilla gorilla UBA52P6
Orangutan Pongo abelii UBA52P7
Gibbon Nomascus leucogenys UBA52P1
Green monkey Chlorocebus sabaeus UBA52P5
Crab-eating macaque Macaca fascicularis UBA52P12
Rhesus Macaca mulatta UBA52P11
Baboon Papio anubis UBA52P10
Golden snub-nosed monkey Rhinopithecus roxellana UBA52P13
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>UBA52P6
CTCTTTTTCTTCAGCGAGGCAGCCGAGCTGCAGACACAGAGATGCAGATCTTTGTGAAGACCCTCACGGGCAAGACCATCACCCTTGAGGTCGAGCCCAGTGACACCATTGAGAATGTCAGTGCGAAAATTCAAGACAAGGAGGGTATCCCCCCTGACAAGCAGCGTCTGATATTTGCCAGCAAACAGCTGGAGGATGGCCGCACTCTCTCAGACTACAACGTCCAGAAACAGCCCACCCCGCACCTGGTGCTGCACCTGCGAGGTGGCATTATTGAGCCTTCACTCTTCCAGCTCACCTAGAAATACAGCTGAAACAAGATGATCTGCCATAAGCGCTATGCTCTCCTGCACCCCTATGCTGTCAATTGCCGCAAGAAGAAGTGTGGCCACACCAACAACCTGCACCCCAAGAAGGTCAAATAAGGCTCTTCCTTCCTCGGAGGGCAGCCTCCTGCCCAGGCCCCATGGCCCTGGAGCCTCAATAAAGTGTCCCTTTCATTGACTGGA
>XM_005260053.3
GCTCCGTGCGCAAGCGCTTTCGGCGGCGATTAGGTGGTTTCCGGTTCCGCTATCTTCTTTTTCTTCAGCGAGGCGGCCGAGCTGACGCAAACATGCAGATCTTTGTGAAGACCCTCACTGGCAAAACCATCACCCTTGAGGTCGAGCCCAGTGACACCATTGAGAATGTCAAAGCCAAAATTCAAGACAAGGAGGGTATCCCACCTGACCAGCAGCGTCTGATATTTGCCGGCAAACAGCTGGAGGATGGCCGCACTCTCTCAGACTACAACATCCAGAAAGAGTCCACCCTGCACCTGGTGTTGCGCCTGCGAGGTGGCATTATTGAGCCTTCTCTCCGCCAGCTTGCCCAGAAATACAACTGCGACAAGATGATCTGCCGCAAGTATGTGTGCTCCGATGCTTGGGGGGCTGTGGGGGCTGCCGGAGTCGGGGTATGCCCTCACCCACCCCTCCTGTCTCTGTGCAGGTGCTATGCTCGCCTTCACCCTCGTGCTGTCAACTGCCGCAAGAAGAAGTGTGGTCACACCAACAACCTGCGTCCCAAGAAGAAGGTCAAATAAGGTGGTTCTTTCCTTGAAGGGCAGCCTCCTGCCCAGGCCCCGTGGCCCTGGAGCCTCAATAAAGTGTCCCTTTCATTGACTGGAGCAGCAA

Publications

PMID - Link Title