Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name LAGE3P1
Wait
Plot displaying the genomic locations of a retrocopy (in chr9) and its respective parental gene (in chrX). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr9:33019585-33020139  UCSC
Coordinates (T2T) chr9:33036144-33036698  UCSC
Coordinates (hg19) chr9:33019583-33020137  UCSC
Strand -
Parental Sequence NM_006014.4
Parental seq. overlap 500 bp
Parental seq. overlap (%) 52.6%
Genomic Region Intragenic (APTX)
Retrocopy Summary LAGE3P1, located on chr9:33019585-33020139, is a retrocopy of the parental gene LAGE3. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name LAGE3
Full Name L antigen family member 3
Also known as CVG5|DXS9879E|DXS9951E|ESO3|GAMOS2|ITBA2|Pcc1
Coordinate chrX:154477769-154479257
Strand -
Gene summary This gene belongs to the ESO/LAGE gene family, members of which are clustered together on chromosome Xq28, and have similar exon-intron structures. Unlike the other family members which are normally expressed only in testis and activated in a wide range of human tumors, this gene is ubiquitously expressed in somatic tissues. The latter, combined with the finding that it is highly conserved in mouse and rat, suggests that the encoded protein is functionally important. An intronless pseudogene with high sequence similarity to this gene is located on chromosome 9. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes LAGE3P1
Bonobo Pan paniscus LAGE3P1
Gorilla Gorilla gorilla LAGE3P1
Orangutan Pongo abelii LAGE3P1
Gibbon Nomascus leucogenys LAGE3P1
Green monkey Chlorocebus sabaeus LAGE3P2
Crab-eating macaque Macaca fascicularis LAGE3P2
Rhesus Macaca mulatta LAGE3P2
Baboon Papio anubis LAGE3P2
Golden snub-nosed monkey Rhinopithecus roxellana LAGE3P1
Marmoset Callithrix jacchus CSTBP1
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Massive Mining of Publicly Available RNA-seq Data from Human and Mouse - (ARCHS4)

AdiposeBone MarrowBreast Mammary TissueBrain CerebellumColonColon Colonic MucosaEsophagusHeartHeart VentricleKidneyLiverBrain MidbrainOvaryPancreasBrain PonsKidney CortexEye RetinaMuscle SkeletalSkinSmall IntestineBrain Spinal CordSpleenTestisThymusTracheaHeart ValveMuscle Smooth0123
log10(TPM+1)

Related Sequence

>LAGE3P1
GGCGGTTATGTGGGACGTGGATGCAGACGCAGGCGGAGGCGCCAACTGCGGGGATGGCTAGGGTGATCACAGCTGCCCCGGGGGCGCGGACACCCCGGCAGCTCCGGCCAGCGGAGCTCCCCCACCGCACGTGTCAGGTCCTAGCAGAAACGCAGCGTCTGTGGCCAAGGGCCAGGAATGCGGCCGCACATATTCACCCTCAGCGTGCCTTTCCCGACCCCCTTAGAGGTGGAAATTGCCCATGGGTCCCTGGCTCCAGATGCCGAACCCCACCAAAGGGTGGTTGGGAAGGATCTCACAGTGAGCGGCAGGATCCTGGCCGTCCGCTGGAAAGCTGAAGACTGTTGCCTGCTCCGAATTTCCCTTATCAACTTTCTCGACCATCTTTCTCTGGTGGTGCGGACCCTGCAGCACTTTGGGCCCCCAGTTTCCCGCTAAGCCTGGCCTGGGAAAATGGGGCGAGGTCTAACCTTGCGTCTCCTCCTAGGCAGTGCATCCATCCTCCCTAGGGCAGGGAATTCCCACAGTTGCTACTTTCCCGGGAGGGCCTCATGG
>NM_006014.4
GGCGACCACGGTGTCTTCAAAAGCCCCGTCAGGGTTGGCTTCCTGGGGCCGGACCGACTGTGGGTCAGTTTGCACCAGCGCTCTGGAATCGAGTTACGCGCGAAAGGGCAGAGTTTCTGGAGGAAACCGCAGCCTCTCAACCGCTGACCGGGTCTCAGAAGGCCCCCGGCAGGGCCGCTTGGCGGGAACTGACCACGCGCCAGTCAGGCTCTCCAGGGACCTGCGCAGGCGCGTGTGGGCGGAGTCGTGCGCAGGGGGCGGGGCTTCGGGAAGGAGCCACAGAGAGGGCGGGGCGTAGGACCTGCGCTTCGGGGGTGGAGTcggagcggcgcggcggcggtcatgcgggacgcggatgcagacgcaggcggaggcgctgacgGCGGGGATGGCCGGGGTGGCCACAGCTGCCGCGGGGGCGTGGACACAGCCGCAGCTCCGGCCGGTGGAGCTCCCCCAGCGCACGCGCCAGGTCCGGGCAGAGACGCCGCGTCTGCGGCCAGGGGGTCACGAATGCGGCCGCACATATTCACCCTCAGCGTGCCTTTCCCGACCCCCTTGGAGGCGGAAATCGCCCATGGGTCCCTGGCACCAGATGCCGAGCCCCACCAAAGGGTGGTTGGGAAGGATCTCACAGTGAGTGGCAGGATCCTGGTCGTCCGCTGGAAAGCTGAAGACTGTCGCCTGCTCCGAATTTCCGTCATCAACTTTCTTGACCAGCTTTCCCTGGTGGTGCGGACCATGCAGCGCTTTGGGCCCCCCGTTTCCCGCTAAGCCTGGCCTGGGCAAATGGAGCGAGGTCCCACTTTGCGTCTCCTTGTAGGCAGTGCGTCCATCCTTCCCTAGGGCAGGAATTCCCACAGTTGCTACTTTCCTGGGAGGGCCTCATGTTTTATCTGGTTCTTAAATGTTTGTTACTACAGAAAATAAAACTGCGCTACTATTCCAA

Publications

PMID - Link Title
No publications available for this retrocopy