Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name MT1P1
Wait
Plot displaying the genomic locations of a retrocopy (in chr9) and its respective parental gene (in chr16). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr9:95413127-95413472  UCSC
Coordinates (T2T) chr9:107582633-107582978  UCSC
Coordinates (hg19) chr9:98175409-98175754  UCSC
Strand -
Parental Sequence NM_175617.4
Parental seq. overlap 301 bp
Parental seq. overlap (%) 74.7%
Genomic Region Intergenic
Retrocopy Summary MT1P1, located on chr9:95413127-95413472, is a retrocopy of the parental gene MT1E. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name MT1E
Full Name metallothionein 1E
Also known as MT-1E|MT-IE|MT1|MTD
Coordinate chr16:56625781-56627112
Strand +
Gene summary Predicted to enable zinc ion binding activity. Involved in cellular response to cadmium ion and cellular response to zinc ion. Located in cytoplasm and nucleus. [provided by Alliance of Genome Resources, Apr 2022]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes MT1MP1
Bonobo Pan paniscus LOC100987821P1
Orangutan Pongo abelii LOC100936088P4
Gibbon Nomascus leucogenys LOC100604314P1
Green monkey Chlorocebus sabaeus LOC103233034P1
Crab-eating macaque Macaca fascicularis LOC102138737P1
Rhesus Macaca mulatta MT1EP2
Baboon Papio anubis LOC101022563P1
Golden snub-nosed monkey Rhinopithecus roxellana LOC104664025P1
Marmoset Callithrix jacchus LOC100894903P1
Gorilla Gorilla gorilla Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Adipose SubcutaneousMuscle SkeletalArtery TibialArtery CoronaryHeart Atrial AppendageAdipose VisceralUterusVaginaBreast Mammary TissueSkin Not Sun ExposedMinor Salivary GlandBrain CortexAdrenal GlandThyroidLungSpleenPancreasEsophagus MuscularisEsophagus MucosaEsophagus Gastroesophageal JunctionStomachColon SigmoidSmall Intestine Terminal IleumColon TransverseProstateTestisNerve TibialSkin Sun ExposedHeart Left VentricleBrain CerebellumWhole BloodArtery AortaPituitaryBrain Frontal CortexBrain CaudateBrain Nucleus AccumbensBrain PutamenBrain HypothalamusBrain Spinal CordBrain HippocampusBrain Anterior Cingulate CortexOvaryBrain Cerebellar HemisphereLiverBrain Substantia NigraKidney CortexBrain AmygdalaCervix EctocervixFallopian TubeCervix EndocervixBladderKidney Medulla00.20.40.60.8
log10(TPM+1)

Related Sequence

>MT1P1
CTCCAGCGTCTCCTTTGCTCAAAACGGACCCCAACAGCTCCTGCACCACTGGCGGCTGCTGGCCCTGTGCTGGCTCCTGCAAATGCAAAGAGTGCAAATGCACCTCCTGCAAGAAGATCTGCTCCTGCTGCCCTGTGGGCTGTGCCAAGTGTGCCCAGGGCTGCATCTGCAAAGGGGCAACAGAGAAGTGCAGCTGCTGTGCCTGATGTGGGGACAGCCCTGCTCCCAGATGTAAATGAAGCAACTTGGATACAAACCTGGATTTTTTTTTTCATATGACCCTGAGCCATTTGCTACATTCCTTTTTCTATAAATATGTAAATAACAGTAAAACACTTTTGACTTA
>NM_175617.4
ATTCTGCTTTCCAACTGCCTGACTGCTTGTTCGTCTCACTGGTGTGAGCTCCAGCATCCCCTTTGCTCGAAATGGACCCCAACTGCTCTTGCGCCACTGGTGGCTCCTGCACGTGCGCCGGCTCCTGCAAGTGCAAAGAGTGCAAATGCACCTCCTGCAAGAAGAGCTGCTGTTCCTGCTGCCCCGTGGGCTGTGCCAAGTGTGCCCAGGGCTGCGTCTGCAAAGGGGCATCGGAGAAGTGCAGCTGCTGTGCCTGATGTGGGAACAGCTCTTCTCCCAGATGTAAATAGAACAACCTGCACAACCTGGATTTTTTTAAAAATACAACACTGAGCCATTTGCTGCATTTCTTTTTATACTAAATATGTGACTGACAATAAAAACAATTTTGACTTTAA

Publications

PMID - Link Title
No publications available for this retrocopy