Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name NPM1P49
Plot displaying the genomic locations of a retrocopy (in chrX) and its respective parental gene (in chr5). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chrX:47438735-47438967  UCSC
Coordinates (T2T) chrX:46848614-46848846  UCSC
Coordinates (hg19) chrX:47298134-47298366  UCSC
Strand -
Parental Sequence NM_001037738.3
Parental seq. overlap 163 bp
Parental seq. overlap (%) 10.2%
Genomic Region Intergenic
Retrocopy Summary NPM1P49, located on chrX:47438735-47438967, is a retrocopy of the parental gene NPM1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name NPM1
Full Name nucleophosmin 1
Also known as B23|NPM
Coordinate chr5:171387116-171410900
Strand +
Gene summary The protein encoded by this gene is involved in several cellular processes, including centrosome duplication, protein chaperoning, and cell proliferation. The encoded phosphoprotein shuttles between the nucleolus, nucleus, and cytoplasm, chaperoning ribosomal proteins and core histones from the nucleus to the cytoplasm. This protein is also known to sequester the tumor suppressor ARF in the nucleolus, protecting it from degradation until it is needed. Mutations in this gene are associated with acute myeloid leukemia. Dozens of pseudogenes of this gene have been identified. [provided by RefSeq, Aug 2017]

Homology

Species Scientific Name Retrocopy
Bonobo Pan paniscus NPM1P45
Gorilla Gorilla gorilla NPM1P45
Gibbon Nomascus leucogenys NPM1P40
Green monkey Chlorocebus sabaeus NPM1P44
Crab-eating macaque Macaca fascicularis NPM1P49
Rhesus Macaca mulatta NPM1P49
Golden snub-nosed monkey Rhinopithecus roxellana NPM1P24
Chimpanzee Pan troglodytes Without Homology
Orangutan Pongo abelii Without Homology
Baboon Papio anubis Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>NPM1P49
AAAAGCCCCAGTGGAGAAATCTATACGAGGCACTCCAGCCAAAAATACACAAAAATCAAACGAGATGAAAATGACTCACTACCATCAACACCAAGATCAGAAGTCAAGAATCCTTTCAAAAACAGGAAAAAACCTCCTAAAACATTGAAAGGACCTAGTTCTATAGAAGACATTAAAGCAAAAT
>NM_001037738.3
CTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCCGCCTTCTCTCCTACCTAAGTGCGTGCCGCCACCCGATGGAAGATTCGATGGACATGGACATGAGCCCCCTGAGGCCCCAGAACTATCTTTTCGGTTGTGAACTAAAGGCCGACAAAGATTATCACTTTAAGGTGGATAATGATGAAAATGAGCACCAGTTATCTTTAAGAACGGTCAGTTTAGGGGCTGGTGCAAAGGATGAGTTGCACATTGTTGAAGCAGAGGCAATGAATTACGAAGGCAGTCCAATTAAAGTAACACTGGCAACTTTGAAAATGTCTGTACAGCCAACGGTTTCCCTTGGGGGCTTTGAAATAACACCACCAGTGGTCTTAAGGTTGAAGTGTGGTTCAGGGCCAGTGCATATTAGTGGACAGCACTTAGTAGCTGTGGAGGAAGATGCAGAGTCAGAAGATGAAGAGGAGGAGGATGTGAAACTCTTAAGTATATCTGGAAAGCGGTCTGCCCCTGGAGGTGGTAGCAAGGTTCCACAGAAAAAAGTAAAACTtgctgctgatgaagatgatgacgatgatgatgaagaggatgatgatgaagatgatgatgatgatgattttgatgatgaggaagctgaagaAAAAGCGCCAGTGAAGAAATCTATACGAGATACTCCAGCCAAAAATGCACAAAAGTCAAATCAGAATGGAAAAGACTCAAAACCATCATCAACACCAAGATCAAAAGGACAAGAATCCTTCAAGAAACAGGAAAAAACTCCTAAAACACCAAAAGGACCTAGTTCTGTAGAAGACATTAAAGCAAAAATGCAAGCAAGTATAGAAAAAGCGCATTGAACAGTCCTGGGCACTACATGTAAATTAAGCCCAAAGATGGGGAGAAAGGAAAAGGAGAGACAAATATAGTCCATACTGAGTGTCATCAACAATCCAGACTGAAGTCTTCTATTTTAATCTCAATCCCCTTTTCTGATTTGCCACCCATGCCTCTTCAGGCTGGAAACAATCTCTTGGTTCCCTAAAGCACTTTCTTCTGACTGCTGTGATTCAGTGAACCTTGCCCTTTGCTTTCTATTACTTGTGCATTTGCCTCACCTGACAATGTTTTAAATCGCCTTTGTATCTCCTTAGCTGCTCAATAAATATTTGAATGCATCAATTAAGAATGTATGTGACAATAATTTTGAAATGGAAATTGTGAGGTTTATTTTACTAGGTTATTGGAGGCAGTTAAGTTTCTTAATGCTATACCTGATTCTGCCAAAGTCCCTTGGACATTTGAAAACCTTTTCAATCTTTTAAAAATGCATAAAAGATACTTAGAGGGAAAGGTATTAATTAAATTTAGTAAAAACAAATATATTCAATGCTTTAaattccaaagtagtgataaatacaaacatttcaagatatttgcaatagtaatgttttgaaattttggttacaaagtcacaggtcttgccaatactgttgtagtttcttgcctatatccgtaatttgaaggaaatggtgagagtgattagagaagtgtaattactgtaattttttcccctattg

Publications

PMID - Link Title