| Retrocopy Name | RPS27AP17 |
|
| Species | Homo sapiens | |
| Coordinates (hg38) | chrX:6989371-6989815 UCSC | |
| Coordinates (T2T) | chrX:6543125-6543569 UCSC | |
| Coordinates (hg19) | chrX:6907412-6907856 UCSC | |
| Strand | + | |
| Parental Sequence | NM_002954.6 | |
| Parental seq. overlap | 391 bp | |
| Parental seq. overlap (%) | 49.6% | |
| Genomic Region |
Intergenic |
|
| Retrocopy Summary | RPS27AP17, located on chrX:6989371-6989815, is a retrocopy of the parental gene RPS27A. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | RPS27A |
| Full Name | ribosomal protein S27a |
| Also known as | CEP80|HEL112|S27A|UBA80|UBC|UBCEP1|UBCEP80 |
| Coordinate | chr2:55231903-55235853 |
| Strand | + |
| Gene summary | Ubiquitin, a highly conserved protein that has a major role in targeting cellular proteins for degradation by the 26S proteosome, is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin fused to an unrelated protein. This gene encodes a fusion protein consisting of ubiquitin at the N terminus and ribosomal protein S27a at the C terminus. When expressed in yeast, the protein is post-translationally processed, generating free ubiquitin monomer and ribosomal protein S27a. Ribosomal protein S27a is a component of the 40S subunit of the ribosome and belongs to the S27AE family of ribosomal proteins. It contains C4-type zinc finger domains and is located in the cytoplasm. Pseudogenes derived from this gene are present in the genome. As with ribosomal protein S27a, ribosomal protein L40 is also synthesized as a fusion protein with ubiquitin; similarly, ribosomal protein S30 is synthesized as a fusion protein with the ubiquitin-like protein fubi. Multiple alternatively spliced transcript variants that encode the same proteins have been identified.[provided by RefSeq, Sep 2008] |
| Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | RPS27AP22 |
![]() |
Gorilla | Gorilla gorilla | RPS27AP25 |
![]() |
Orangutan | Pongo abelii | RPS27AP25 |
![]() |
Gibbon | Nomascus leucogenys | RPS27AP21 |
![]() |
Green monkey | Chlorocebus sabaeus | RPS27AP21 |
![]() |
Crab-eating macaque | Macaca fascicularis | RPS27AP23 |
![]() |
Rhesus | Macaca mulatta | RPS27AP23 |
![]() |
Baboon | Papio anubis | RPS27AP22 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | LOC104673976P8 |
![]() |
Bonobo | Pan paniscus | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >RPS27AP17 |
| ATTGAACCATTGGATACAATAGAAAATGTAAAGGCCAAGACCCAGGATAAGGAAGGAATTTCTCCTGACCAGCAAAGACTGATCTTCGCTGTCAAGCAACTGGAAGATGGACGTACTTTGTCTGACTACAACATTCAAGAGGAGTCCACTCTTCATCATGTGTTGAGATTTCATGGTGGTGCTAAGAAAATGAAGAAGTCTTATGCCATTGCCAAAAAGAATATGCATTACAGAAAGAAGATTAAGCTGGCTGTCCTGAAAAACTCCAAGGTGCATGACAATGGCAAAATTGGTTGCCTTCATGGGAAGTGCCTTTTAGATGAATGTGGTGCAGGAGGTTTTATGGCCAGCCACTTTGACAGGCATTATTGTGGCAAATGTTGTCTTATTGCTTCAACAAACCAGACAAGTAATCGTGTATGAGTTAATAAGAGACATGAACTAA |
| >NM_002954.6 |
| CTTTTCGATCCGCCATCTGCGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACCCTTACGGGGAAGACCATCACCCTCGAGGTTGAACCCTCGGATACGATAGAAAATGTAAAGGCCAAGATCCAGGATAAGGAAGGAATTCCTCCTGATCAGCAGAGACTGATCTTTGCTGGCAAGCAGCTGGAAGATGGACGTACTTTGTCTGACTACAATATTCAAAAGGAGTCTACTCTTCATCTTGTGTTGAGACTTCGTGGTGGTGCTAAGAAAAGGAAGAAGAAGTCTTACACCACTCCCAAGAAGAATAAGCACAAGAGAAAGAAGGTTAAGCTGGCTGTCCTGAAATATTATAAGGTGGATGAGAATGGCAAAATTAGTCGCCTTCGTCGAGAGTGCCCTTCTGATGAATGTGGTGCTGGGGTGTTTATGGCAAGTCACTTTGACAGACATTATTGTGGCAAATGTTGTCTGACTTACTGTTTCAACAAACCAGAAGACAAGTAACTGTATGAGTTAATAAAAGACATGAACTAACATTTATTGTTGGGTTTTATTGCAGTAAAAAGAATGGTTTTTAAGCACCAAATTGATGGTCACACCATTTCCTTTTAGTAGTGCTACTGCTATCGCTGTGTGAATGTTGCCTCTGGGGATTATGTGACCCAGTGGTTCTGTATACCTGCCAGGTGCCAACCACTTGTAAAGGTCTTGATATTTTCAATTCTTAGACTACCTATACTTTGGCAGAAGTTATATTTAATGTAAGTTGTCTAAATATAA |
| PMID - Link | Title |
|---|