Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name BUD31P2
Wait
Plot displaying the genomic locations of a retrocopy (in chrX) and its respective parental gene (in chr7). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chrX:75201545-75201792  UCSC
Coordinates (T2T) chrX:73635217-73635464  UCSC
Coordinates (hg19) chrX:74421380-74421627  UCSC
Strand +
Parental Sequence NM_001370410.1
Parental seq. overlap 208 bp
Parental seq. overlap (%) 25.7%
Genomic Region Intragenic (UPRT)
Retrocopy Summary BUD31P2, located on chrX:75201545-75201792, is a retrocopy of the parental gene BUD31. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name BUD31
Full Name BUD31 homolog
Also known as Cwc14|EDG-2|EDG2|G10|YCR063W|fSAP17
Coordinate chr7:99408641-99419616
Strand +
Gene summary Enables nuclear receptor binding activity and nuclear receptor coactivator activity. Involved in mRNA splicing, via spliceosome and positive regulation of androgen receptor activity. Located in nucleus. Part of U2-type catalytic step 2 spliceosome. Colocalizes with chromatin. [provided by Alliance of Genome Resources, Apr 2022]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes BUD31P2
Bonobo Pan paniscus BUD31P2
Gorilla Gorilla gorilla BUD31P1
Orangutan Pongo abelii BUD31P1
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Related Sequence

>BUD31P2
GTTTATAAGTGGAAAGTCATAACCAGAGCACTCTATGAATATTGTATTAAAGAAGGCTATGCAGGAAAAAACCTAATCACAATATGGAAAAAGCAAGGCTATGAGAACTTGTGCTGGCTGCTGTGCCTTCAGACATGGAACACCAATTTTGGGACAAACTGCAATTGCTGTGTTCCTAAAACAAAGATAGAAGTGGGCTGCATCATTGAGTGCATGCACTGTGGCTGCCAGGGCTGCTCTAGCTGAGG
>NM_001370410.1
GTCGAGAAGCAGCTACCCAAGCTCCAGGAGCTTCCGaaacaggaccagagagggaaggtgacctgaaagtcacagaataattttttagagctgaacaagaatccaagcctgcaactgcagagacgagagatctttctgctgtctatactCTTGGAAAGCACATCCTAAGATCTTTGCAGATTATCCTGTGGAAGGAAAATGCCTAAAGTCAAAAGAAGCCGGAAAGCACCCCCAGATGGCTGGGAGTTGATTGAGCCAACACTGGATGAATTAGATCAAAAGATGAGAGAAGCTGAAACAGAACCGCATGAGGGAAAGAGGAAAGTGGAATCTCTGTGGCCCATCTTCAGGATCCACCACCAGAAAACCCGCTACATCTTCGACCTCTTTTACAAGCGGAAAGCCATCAGCAGAGAACTCTATGAATATTGTATTAAAGAAGGCTATGCAGACAAAAACCTGATTGCAAAATGGAAAAAGCAAGGATATGAGAACTTGTGCTGCCTGCGGTGCATTCAGACACGGGACACCAACTTCGGGACGAACTGCATCTGCCGCGTGCCCAAAAGCAAGCTGGAAGTGGGCCGCATCATCGAGTGCACACACTGTGGCTGTCGTGGCTGCTCTGGCTGAGGCTGGCGCGCTCCACCCTGGACTCTGGACTTCGCAGGTTCCTGCCTGTCACGCCACCCCCTTCCTGGGAGCAGCGAGCAGTGCCCCAGGCCCGAGTTGGAGCACGGTCTCTATGGGGAAGGCTTCGCTGTCTATCAGCTGTGATTTGTAAAAATAAAATCTTTAAATCTCTCGA

Publications

PMID - Link Title
No publications available for this retrocopy