Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name NDUFB4P7
Wait
Plot displaying the genomic locations of a retrocopy (in chr14) and its respective parental gene (in chr3). Each line represents a retrocopy.
Species Pan troglodytes
Coordinates chr14:84095416-84095564  UCSC
Strand +
Parental Sequence NM_001071792.1
Parental seq. overlap 128 bp
Parental seq. overlap (%) 32.8%
Genomic Region Intergenic
Retrocopy Summary NDUFB4P7, located on chr14:84095416-84095564, is a retrocopy of the parental gene NDUFB4. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name NDUFB4
Full Name NADH:ubiquinone oxidoreductase subunit B4
Also known as -
Coordinate chr3:118761279-118767219
Strand +
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Human Homo sapiens NDUFB4P11
Bonobo Pan paniscus NDUFB4P8
Gorilla Gorilla gorilla NDUFB4P8
Orangutan Pongo abelii NDUFB4P6
Gibbon Nomascus leucogenys NDUFB4P9
Green monkey Chlorocebus sabaeus NDUFB4P8
Crab-eating macaque Macaca fascicularis NDUFB4P5
Rhesus Macaca mulatta NDUFB4P5
Baboon Papio anubis NDUFB4P5
Golden snub-nosed monkey Rhinopithecus roxellana NDUFB4P4
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>NDUFB4P7
CTTCAGACTCACTCCCAGAAACTCACTCTTGGGAGCTCTCTGTGGAATTGGGCCCCCCTTCTTCTGGTATTATGTTTTCAAAACTGACAGGGATATGAAAGAAAAACTTATCCAGGAAAGAAAATTGGGTTGAACATTTAACATCTCAT
>NM_001071792.1
ATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCGCACTCTGCCTGAGACCCTCGACCCAGCCGAATACAACATATCTCCGGAAACCCGGCGGGCGCAAGCCGAGCGGTTGGCCATAAGAGCCCAGCTGAAACGAGAGTACCTGCTTCAGTACAACGATCCCAACCGCCGAGGGCTCATCGAAAATCCTGCCTTGCTTCGTTGGGCCTATGCAAGAACAATAAATGTCTATCCTAATTTCAGACCCACTCCTAAAAACTCACTCATGGGAGCTCTGTGTGGATTTGGGCCCCTCATCTTCATTTATTATATTATCAAAACTGAGAGGGATAGGAAAGAAAAACTTATCCAGGAAGGAAAATTGGATCGAACATTTCACCTCTCATATTAA

Publications

PMID - Link Title
No publications available for this retrocopy