 
    | Retrocopy Name | RPL30P12 |  | 
| Species | Pan troglodytes | |
| Coordinates | chr8:55363732-55364023 UCSC | |
| Strand | + | |
| Parental Sequence | XM_003311862.5 | |
| Parental seq. overlap | 248 bp | |
| Parental seq. overlap (%) | 44.9% | |
| Genomic Region | Intergenic | |
| Retrocopy Summary | RPL30P12, located on chr8:55363732-55364023, is a retrocopy of the parental gene RPL30. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. | 
| Gene Name | RPL30 | 
| Full Name | ribosomal protein L30 | 
| Also known as | - | 
| Coordinate | chr8:95969313-95973198 | 
| Strand | - | 
| Gene summary | N/A | 
| Species | Scientific Name | Retrocopy | |
|  | Human | Homo sapiens | RPL30P10 | 
|  | Bonobo | Pan paniscus | RPL30P13 | 
|  | Gorilla | Gorilla gorilla | RPL30P11 | 
|  | Orangutan | Pongo abelii | RPL30P12 | 
|  | Green monkey | Chlorocebus sabaeus | RPL30P6 | 
|  | Crab-eating macaque | Macaca fascicularis | RPL30P9 | 
|  | Rhesus | Macaca mulatta | RPL30P11 | 
|  | Baboon | Papio anubis | RPL30P12 | 
|  | Golden snub-nosed monkey | Rhinopithecus roxellana | RPL30P13 | 
|  | Gibbon | Nomascus leucogenys | Without Homology | 
|  | Marmoset | Callithrix jacchus | Without Homology | 
|  | Mouse lemur | Microcebus murinus | Without Homology | 
|  | Mouse | Mus musculus | Without Homology | 
|  | Rat | Rattus norvegicus | Without Homology | 
|  | Chinese hamster | Cricetulus griseus | Without Homology | 
|  | Rabbit | Oryctolagus cuniculus | Without Homology | 
|  | Pig | Sus scrofa | Without Homology | 
|  | Cow | Bos taurus | Without Homology | 
|  | Sheep | Ovis aries | Without Homology | 
|  | Dolphin | Tursiops truncatus | Without Homology | 
|  | Horse | Equus caballus | Without Homology | 
|  | Dog | Canis familiaris | Without Homology | 
|  | Panda | Ailuropoda melanoleuca | Without Homology | 
|  | Cat | Felis catus | Without Homology | 
|  | Pale spear-nosed bat | Phyllostomus discolor | Without Homology | 
|  | Velvety free-tailed bat | Molossus molossus | Without Homology | 
|  | Greater mouse-eared bat | Myotis myotis | Without Homology | 
|  | Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology | 
|  | Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology | 
|  | Egyptian rousette | Rousettus aegyptiacus | Without Homology | 
|  | Sloth | Choloepus didactylus | Without Homology | 
|  | Tasmanian Devil | Sarcophilus harrisii | Without Homology | 
|  | Opossum | Monodelphis domestica | Without Homology | 
|  | Platypus | Ornithorhynchus anatinus | Without Homology | 
|  | Chicken | Gallus gallus | Without Homology | 
|  | Turkey | Meleagris gallopavo | Without Homology | 
|  | Zebra Finch | Taeniopygia guttata | Without Homology | 
|  | Budgerigar | Melopsittacus undulatus | Without Homology | 
|  | Painted Turtle | Chrysemys picta | Without Homology | 
|  | Lizard | Anolis Carolinensis | Without Homology | 
|  | Frog | Xenopus tropicalis | Without Homology | 
|  | Zebrafish | Danio rerio | Without Homology | 
|  | Drosophila | Drosophila melanogaster | Without Homology | 
| >RPL30P12 | 
| GGTTATGAAAAATGGAAAGTACGTACTGGGGTACAAGCACACTCTGAAGATGATCAGACATGGCAAAGCAAAATTAGTCATCCCCACTAACAATTGGCCAGCTTTGAGGAAATCCAAAATAGAGAACTATGCAATGTTGGCCAAAACTAATGTCCATCACTATAGTGAAAACAGTATTGAATTGGGCACGGCATGAGAAAAATACTACAGATTATGCACAGTGGCTGTCATTGATCTAGATGATTCTGATATCATTAGAAGCATGCCAAAATAGGCTGGTGAGAAATAAACC | 
| >XM_003311862.5 | 
| gtcccgcAGTTCCGGCTCTGCCCTGAAGAGCTTTGCATTGTGGGAAGTCTTTCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTTGGGGGCCGTCCCGCACCTAAGGCAGGAAGATGGTGGCCGCAAAGAAGACGAAAAAGTCGCTGGAGTCGATCAACTCTAGGCTCCAACTCGTTATGAAAAGTGGGAAGTACGTCCTGGGGTACAAGCAGACTCTGAAGATGATCAGACAAGGCAAAGCGAAATTGGTCATTCTGGCAAACAACTGCCCAGCTTTGAGGAAATCTGAAATAGAGTACTATGCTATGTTGGCTAAAACTGGTGTCCATCACTACAGTGGCAATAATATTGAACTGGGCACAGCATGCGGAAAATACTACAGAGTGTGCACACTGGCTATCATTGATCCAGGTGACTCTGACATCATTAGAAGCATGCCAGAACAGACTGGTGAAAAGTAAACCTTTTCACCTACAAAATTTCACCTGCAAACCTTAAACCTGCAAAATTTTCCTTTAATAAAATTTGCTTGTTTTAAAAACA | 
| PMID - Link | Title | 
|---|