Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name TOMM7P1
Plot displaying the genomic locations of a retrocopy (in chr4) and its respective parental gene (in chr7). Each line represents a retrocopy.
Species Pan troglodytes
Coordinates chr4:96245039-96245236  UCSC
Strand -
Parental Sequence XM_016945537.2
Parental seq. overlap 162 bp
Parental seq. overlap (%) 35.3%
Genomic Region Intergenic
Retrocopy Summary TOMM7P1, located on chr4:96245039-96245236, is a retrocopy of the parental gene TOMM7. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name TOMM7
Full Name translocase of outer mitochondrial membrane 7
Also known as -
Coordinate chr7:22955141-22964713
Strand -
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Human Homo sapiens TOMM7P1
Bonobo Pan paniscus TOMM7P1
Gorilla Gorilla gorilla TOMM7P1
Orangutan Pongo abelii TOMM7P1
Gibbon Nomascus leucogenys TOMM7P2
Green monkey Chlorocebus sabaeus TOMM7P1
Crab-eating macaque Macaca fascicularis TOMM7P1
Rhesus Macaca mulatta TOMM7P1
Baboon Papio anubis TOMM7P1
Golden snub-nosed monkey Rhinopithecus roxellana TOMM7P1
Cow Bos taurus TOMM7P1
Sheep Ovis aries TOMM7P1
Dolphin Tursiops truncatus TOMM7P3
Horse Equus caballus TOMM7P1
Panda Ailuropoda melanoleuca TOMM7P5
Greater horseshoe bat Rhinolophus ferrumequinum TOMM7P1
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Dog Canis familiaris Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>TOMM7P1
CCATGGTGATGCCGGGCAAAGAGGCCAAGCAGAGGCTGCAGTAGCTTTTCAAGGGCAGTCCATTTTCCATCTGCTGGGGCTTTATTCATCTCATGACTTACCTGGAACTAAAGAAGGGTATAGAGCCTGGGATGTCTGAACCAATCGTTTTGAGCCTGCTTTGGAGATAAAGGACTATTTGATCATCTGGATTTGGAA
>XM_016945537.2
TGTGGCGCCTGCGCACCTCCTTTCCCTTTCGGATTCCCGACGCGGTGGTTTTTGTAAGGGGTCCTCCCTGCGCCACACGGCCGTCGCCATGGTGAAGCTGAGCAAAGAGGCCAAGCAGAGACTACAGCAGCTCTTCAAGGGGGGCCAGTTTGCCATTCGCTGGGGCTTTATCCCTCTTGTGATTTACCTGGGATTTAAGAGGGGTGCAGATCCTGGAATGCCTGAACCAACTGTTTTGAGCCTACTTTGGGGATAAAGGATTATTTGGTCTTCTGGATTTGGAGGCAATCAGCGGACAGCATGGAAGATGTATGCTCTGGCTCGGATAAGAGATGGGACATCATTCAGTCACTAGTTGGATGGCACAAGGCTCTTCACAGATGCATCTGTAGCAGAGTGGAACTTGTACTAACTTATGATAGAATGTATCAGAATAAATGTTTTTAACAATGTTA

Publications

PMID - Link Title