Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name LOC102142606P1
Plot displaying the genomic locations of a retrocopy (in chr15) and its respective parental gene (in chr20). Each line represents a retrocopy.
Species Macaca fascicularis
Coordinates chr15:77928442-77928593  UCSC
Strand +
Parental Sequence XM_005591989.2
Parental seq. overlap 132 bp
Parental seq. overlap (%) 26.2%
Genomic Region Intergenic
Retrocopy Summary LOC102142606P1, located on chr15:77928442-77928593, is a retrocopy of the parental gene LOC102142606. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name LOC102142606
Full Name N/A
Also known as -
Coordinate chr20:44687426-44690111
Strand -
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Human Homo sapiens MT1GP1
Chimpanzee Pan troglodytes MT1LP1
Bonobo Pan paniscus LOC100987488P4
Gorilla Gorilla gorilla LOC109023582P1
Orangutan Pongo abelii LOC100435295P1
Gibbon Nomascus leucogenys LOC100605310P1
Green monkey Chlorocebus sabaeus LOC103233041P1
Rhesus Macaca mulatta MT1XP1
Baboon Papio anubis LOC100999208P1
Golden snub-nosed monkey Rhinopithecus roxellana LOC104664026P1
Marmoset Callithrix jacchus LOC103790482P1
Mouse lemur Microcebus murinus LOC105866554P1
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>LOC102142606P1
TCCCAACTGGTCCTGGCCACTTGTGGCTCCTGCACCTGTGCTGGCTCCTGAAAATGCAAAAAAATGCAAATGCACCTTCTGCAAAAAGAGCTGCTGCTCCTGTTGCTCTGTGGGCTGTGCCAAGTGTGCCCAGGACCTCACCTGCAAAGGGG
>XM_005591989.2
GACAGCTGGCGGTGCTGACTCggcggggcgggtgcaagggcggggcggggcgTCTGCGCCCGGCCCCCTTTCTTGACTATAAATGCAGCCGCTGGCTGTTGGGCTCCACCACGCCTTCCATGTCCACCACTGCCTCTTCTCTTCTCGCTTCGGAACTCCACTCTTGCCTCCTGTTGCAATGGACCCCAACTGCTCCTGCGCCTCTGGTGTCTCCTGCACCTGCCCTGGCTCCTGCAAGTGCAAAGAGTGCAAATGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGCCCTGTGGGCTGTGCCAAGTGTGCCCAGGGCTGCATCTGCAAAGGGGTGTTGGACAAGTGCTGCTGCTGCGCCTGATGCTGGGACAGCCCTGCTCCCAAATATAGATTGATTAGTAAAATCCAGGATTTTTTGCTTTTTTGATACAACCTTGACCCATTTGCTGCATTCCTTTTCCTGTGAAATATGTGAATCATAATTAAACACTTAGACTTGA

Publications

PMID - Link Title