Retrocopy Name | MT1GP1 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr9:1247170-1247373 UCSC | |
Coordinates (T2T) | chr9:1248839-1249042 UCSC | |
Coordinates (hg19) | chr9:1247170-1247373 UCSC | |
Strand | - | |
Parental Sequence | NM_005950.3 | |
Parental seq. overlap | 176 bp | |
Parental seq. overlap (%) | 43% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | MT1GP1, located on chr9:1247170-1247373, is a retrocopy of the parental gene MT1G. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | MT1G |
Full Name | metallothionein 1G |
Also known as | MT1|MT1K |
Coordinate | chr16:56666730-56668065 |
Strand | - |
Gene summary | Enables zinc ion binding activity. Involved in cellular response to metal ion; cellular response to vascular endothelial growth factor stimulus; and negative regulation of growth. Located in cytoplasm and nucleus. [provided by Alliance of Genome Resources, Apr 2022] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | MT1LP1 |
![]() |
Bonobo | Pan paniscus | LOC100987488P4 |
![]() |
Gorilla | Gorilla gorilla | LOC109023582P1 |
![]() |
Orangutan | Pongo abelii | LOC100435295P1 |
![]() |
Gibbon | Nomascus leucogenys | LOC100605310P1 |
![]() |
Green monkey | Chlorocebus sabaeus | LOC103233041P1 |
![]() |
Crab-eating macaque | Macaca fascicularis | LOC102142606P1 |
![]() |
Rhesus | Macaca mulatta | MT1XP1 |
![]() |
Baboon | Papio anubis | LOC100999208P1 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | LOC104664026P1 |
![]() |
Marmoset | Callithrix jacchus | LOC103790482P1 |
![]() |
Mouse lemur | Microcebus murinus | LOC105866554P1 |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>MT1GP1 |
ACCCCGACTGGTCCTGGCCACTGGTGGCTCCTGCACCTGTGCTGGCTCCTGAAAAATGCAAAAAATGCAAATGCTCCTTCTGCAAAAAGAGCTGCTGCTCCTGCTGCTCTGTGGACTGTGCCAAGTGTGCCCAGGACCTCATCTGCAAAGGGGCATCAGACAGTGCAGCTGTTGTGCTGGATGTCAGGACAGTCCTGCTCCCAG |
>NM_005950.3 |
ACTCCGCCTTCCACGTGCACCCACTGCCTCTTCCCTTCTCGCTTGGGAACTCTAGTCTCGCCTCGGGTTGCAATGGACCCCAACTGCTCCTGTGCCGCTGGTGTCTCCTGCACCTGCGCCAGCTCCTGCAAGTGCAAAGAGTGCAAATGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGCCCTGTGGGCTGTGCCAAGTGTGCCCAGGGCTGCATCTGCAAAGGGGCATCGGAGAAGTGCAGCTGCTGCGCCTGATGTCGGGACAGCCCTGCTCCCAAGTACAAATAGAGTGACCCGTAAAATCCAGGATTTTTTGTTTTTTGCTACAATCTTGACCCCTTTGCTACATTCCTTTTTTTCTGTGAAATATGTGAATAATAATTAAACACTTAGACTTGATTCCC |
PMID - Link | Title |
---|