Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name COX6B1P1
Plot displaying the genomic locations of a retrocopy (in chr1) and its respective parental gene (in chr19). Each line represents a retrocopy.
Species Pongo abelii
Coordinates chr1:159207712-159207898  UCSC
Strand -
Parental Sequence NM_001131741.1
Parental seq. overlap 160 bp
Parental seq. overlap (%) 32.9%
Genomic Region Intergenic
Retrocopy Summary COX6B1P1, located on chr1:159207712-159207898, is a retrocopy of the parental gene COX6B1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name COX6B1
Full Name N/A
Also known as -
Coordinate chr19:33327191-33337990
Strand +
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Human Homo sapiens COX6B1P7
Chimpanzee Pan troglodytes COX6B1P1
Bonobo Pan paniscus LOC100972703P1
Gorilla Gorilla gorilla LOC101139203P1
Gibbon Nomascus leucogenys LOC100606627P3
Crab-eating macaque Macaca fascicularis LOC102143756P1
Rhesus Macaca mulatta COX6B1P1
Baboon Papio anubis LOC101010708P1
Golden snub-nosed monkey Rhinopithecus roxellana LOC104667089P6
Mouse lemur Microcebus murinus LOC105876919P1
Green monkey Chlorocebus sabaeus Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>COX6B1P1
CTTTAGGAGTTAACACCATGGCAGAAGACATGGAGACCAAATCAAGAACTACAGGACTGCCCCTTGTGGCAGTTCTTCCCCAGCCAGAACTAGACCAGGAACTACTGGTAGACCTACCTGGAATTCCACTGCTGCCAGAAGGCAATGACTGCTAAAGGGGGTTATGTCTTTGTGTGTGAATGGTACA
>NM_001131741.1
TTCCGCTTCCTGTGCGACTGTGGTGTCTTTGCTGAGGGTCACATTGAGCTGCAGGTTGCATCCGGGGTGCCTTTAGGATTCAGCACTATGGCGGAAGACATGGAGACCAAACTCAAGAACTACAAGACTGCCCCTTTTGACAGCCGCTTCCCCAACCAGAACCAGACCAGAAACTGCTGGCAGAACTACCTGGACTTCCACCGCTGTCAGAAGGCAATGACCGCTAAAGGAGGCGATATCTCTGTGTGCGAATGGTACCAGCGTGTGTACCAGTCCCTCTGCCCCACATCCTGGGTCACAGACTGGGATGAGCAACGGGCTGAAGGCACGTTTCCCGGGAAGATCTGAACTGGCTGCGTCTCCCTTTCCTTTGTCCTCCGTCCTTCTCCCAGGATGGTGAAGGGGGATGTAGTACCCCGTGATCCCCACCCCGGGATCCTAAATCAATCATGACTTACCTGCTAATAAAAACTCATTGGAAAAGTGA

Publications

PMID - Link Title