Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name Calm3P1
Plot displaying the genomic locations of a retrocopy (in chr17) and its respective parental gene (in chr1). Each line represents a retrocopy.
Species Rattus norvegicus
Coordinates chr17:70072439-70072624  UCSC
Strand +
Parental Sequence NM_012518.3
Parental seq. overlap 155 bp
Parental seq. overlap (%) 25.9%
Genomic Region Intergenic
Retrocopy Summary Calm3P1, located on chr17:70072439-70072624, is a retrocopy of the parental gene Calm3. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name Calm3
Full Name calmodulin 3
Also known as CaMIII|Cam3|Camc|RNCAMIII
Coordinate chr1:78844520-78851628
Strand -
Gene summary Enables several functions, including enzyme binding activity; nitric-oxide synthase regulator activity; and transmembrane transporter binding activity. Involved in several processes, including activation of adenylate cyclase activity; regulation of calcium ion transmembrane transporter activity; and regulation of vesicle-mediated transport. Located in several cellular components, including growth cone; myelin sheath; and nucleus. Colocalizes with mitochondrial membrane and synaptic vesicle membrane. Human ortholog(s) of this gene implicated in familial hypertrophic cardiomyopathy. Orthologous to human CALM3 (calmodulin 3). [provided by Alliance of Genome Resources, Apr 2022]

Homology

Species Scientific Name Retrocopy
Human Homo sapiens CALM3P1
Chimpanzee Pan troglodytes CALM3P1
Bonobo Pan paniscus CALM3P1
Orangutan Pongo abelii CALM3P1
Gibbon Nomascus leucogenys CALM3P1
Green monkey Chlorocebus sabaeus CALM3P1
Crab-eating macaque Macaca fascicularis CALM3P1
Rhesus Macaca mulatta CALM3P1
Golden snub-nosed monkey Rhinopithecus roxellana CALM3P1
Mouse Mus musculus Calm3P2
Chinese hamster Cricetulus griseus Calm3_1P1
Gorilla Gorilla gorilla Without Homology
Baboon Papio anubis Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>Calm3P1
GGACTTCCCCGAGTTCCTGACCATGATGTCCAGGAAGATGAAAGACACCGACAGCGAGGAGGAGATCCGGGAGGCCTTCCGGGTGTTTGACAAGGACGGCAACGGCTTCGTCAGCGCAGCTGAGCTGAGGCACGTGATGACCAGGCTTGGGGAGAAGCTGAGCGACGAGGAGGTAGATGAAATGAT
>NM_012518.3
GTGCCTCGCCATGGCTGACCAGCTGACCGAAGAACAGATTGCAGAGTTCAAGGAAGCCTTCTCCCTCTTTGACAAGGATGGAGATGGCACCATTACCACCAAGGAGCTGGGGACTGTGATGAGATCGCTGGGGCAAAACCCCACTGAGGCGGAACTGCAGGACATGATCAATGAGGTGGATGCTGATGGCAATGGGACCATTGACTTCCCAGAGTTCCTGACCATGATGGCCAGAAAGATGAAGGATACAGACAGCGAGGAGGAGATACGAGAGGCCTTCCGTGTCTTTGACAAGGATGGGAATGGCTACATCAGTGCTGCTGAGCTGCGTCACGTCATGACGAACCTGGGGGAGAAGCTGACTGATGAGGAAGTGGATGAGATGATCCGAGAGGCGGACATTGATGGAGACGGCCAGGTCAATTATGAAGAGTTTGTACAGATGATGACTGCGAAGTGAAGGCCCGGGCAGCTGGCCATGCCCGTTCTCCTGATCTCTTCTTGCGCTCTCCTCTCTTCAACACTCCCCTGCGTACCCGGTTCTAGCAAACGCCAATTGATTGACTGAGAATCTGATAAAGCAACAAAAGATTTGTCCC

Publications

PMID - Link Title