Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name Gpx2P2
Wait
Plot displaying the genomic locations of a retrocopy (in chrX) and its respective parental gene (in chr6). Each line represents a retrocopy.
Species Rattus norvegicus
Coordinates chrX:63824317-63824759  UCSC
Strand +
Parental Sequence NM_183403.2
Parental seq. overlap 372 bp
Parental seq. overlap (%) 36.8%
Genomic Region Intergenic
Retrocopy Summary Gpx2P2, located on chrX:63824317-63824759, is a retrocopy of the parental gene Gpx2. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name Gpx2
Full Name glutathione peroxidase 2
Also known as GPX-GI|GSHPx-2|GSHPx-GI
Coordinate chr6:99839960-99843245
Strand -
Gene summary The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of organic hydroperoxides and hydrogen peroxide (H2O2) by glutathione, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme is predominantly expressed in the gastrointestinal tract in rodents, is localized in the cytoplasm, and whose preferred substrate is hydrogen peroxide. Knockout studies in mice lacking this gene suggest a role for this isozyme in intestinal inflammation and colon cancer development. This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Pseudogenes of this locus have been identified on chromosomes 2 and X. [provided by RefSeq, Aug 2017]

Homology

Species Scientific Name Retrocopy
Mouse Mus musculus Gpx2P2
Human Homo sapiens Without Homology
Chimpanzee Pan troglodytes Without Homology
Bonobo Pan paniscus Without Homology
Gorilla Gorilla gorilla Without Homology
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

OvaryBrainHeartLiverTestisKidney00.050.10.15
log10(TPM+1)

Related Sequence

>Gpx2P2
TGGAACAACTACCCAGGACTTCCACCAGCTCCATGAGTTGCAATGTAGCTTTCCCAGGCGACTTTTTGTTCTCAACTTCCTTAGCAACTAGTTTGGATATTAGAAAAACTGTCAGAATGAGATCCTGAACAGCCCTATGTATGTCATCCCTAGGGGTGGGTATCAGTCCACCTTCAGTCTTACCCAAAAATGTGATGTCACTGCACAGAACCAGCATCCCGTCTTTGCCTATCTGAAAGACAAGCTGCTCTACCCATTCTCTTCCACGACCAGTCCCCAGCTCATCATGTGGAGCCATTCAGATGTAGCCTGAAATTTTGTGAAGTTTCTCATAGGGCCAGAAGGGGAGGCCTTCCATTGTTACAACCTCACCTTCCAAACCATCAATATCAACTCTGACATCAAATGTCTCCTCAAAGTTGCCATCTAAAATGTGGGCTGCT
>NM_183403.2
GGGAATGCTCAAAGGCCCTTTGTGAAATTCTTTCTGTCCTTCCTGGCTCCTCCTTCCTCCCCACCCAGTCAAGGAACTTAAGGAGGCTCCCACAGCCGGGCAGGACTCACAGCACTCCAGCATGGCTTACATCGCCAAGTCTTTTTACGATCTCAGTGCCATCGGCCTGGATGGGGAGAAGATAGACTTCAACACGTTCCGAGGCAGGGCCGTGCTGATTGAGAATGTGGCCTCGCTCTGAGGAACAACTACCCGGGACTACACCCAGCTCAATGAGTTGCAGTGCCGCTTTCCCAGGCGCCTAGTGGTTCTCGGCTTCCCTTGCAACCAGTTCGGACATCAGGAGAACTGTCAGAATGAGGAGATCCTGAACAGCCTCAAGTATGTCCGCCCTGGGGGTGGGTTCCAGCCCACCTTCAGTCTTACCCAAAAGTGTGATGTCAATGGGCAGAATCAGCATCCTGTCTTTGCCTACCTGAAAGACAAGCTGCCCTACCCTTATGACGACCCATTCTCCCTCATGACCGATCCCAAGCTCATCATATGGAGTCCGGTGCGCCGCTCAGATGTGTCCTGGAACTTTGAGAAGTTCCTCATAGGGCCAGAAGGGGAGCCTTTCCGTCGCTACAGCCGCACCTTCCAGACCATCAACATCGAGCCTGACATCAAACGTCTCCTCAAAGTTGCCATCTAAATGAGGGCTGCTCAGCCTAGGAATCTCCGACTGTTTCTCCAAGTAGTCCTCTTCAGAGCTCAGTGTACCctcaggagacactgggaaaccgaagcatttcctcaatattgtccccttgccttcctgccacccatttcCTTTAGCTCCCTAAAGGCTCTTGGGGAGTCCACTGGGGGCTCTAAGTCTGGGGTAGGTGCTAGGCCTTCTTCACAGAATGATGGCATCTTCCTAAACCCTTCTGGGGGATGTCTGAGACGTTGTGAAGGGCCCAGAGCCAGCTCGGTTTAGAGTCCAATAAAGGGTAGGAATGACCTGG

Publications

PMID - Link Title
No publications available for this retrocopy