Retrocopy Name | Rps15aP3 |
![]() |
Species | Rattus norvegicus | |
Coordinates | chr2:182812434-182812756 UCSC | |
Strand | - | |
Parental Sequence | NM_053982.1 | |
Parental seq. overlap | 301 bp | |
Parental seq. overlap (%) | 68.6% | |
Genomic Region |
Intragenic (LOC102551394) |
|
Retrocopy Summary | Rps15aP3, located on chr2:182812434-182812756, is a retrocopy of the parental gene Rps15a. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | Rps15a |
Full Name | ribosomal protein S15a |
Also known as | - |
Coordinate | chr1:187759865-187766734 |
Strand | - |
Gene summary | Predicted to be a structural constituent of ribosome. Predicted to be involved in positive regulation of cell cycle; positive regulation of cell population proliferation; and response to virus. Part of cytosolic small ribosomal subunit. Human ortholog(s) of this gene implicated in Diamond-Blackfan anemia 20. Orthologous to human RPS15A (ribosomal protein S15a). [provided by Alliance of Genome Resources, Apr 2022] |
Species | Scientific Name | Retrocopy | |
![]() |
Human | Homo sapiens | Without Homology |
![]() |
Chimpanzee | Pan troglodytes | Without Homology |
![]() |
Bonobo | Pan paniscus | Without Homology |
![]() |
Gorilla | Gorilla gorilla | Without Homology |
![]() |
Orangutan | Pongo abelii | Without Homology |
![]() |
Gibbon | Nomascus leucogenys | Without Homology |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>Rps15aP3 |
GGTTCTTAACTGTGATGATGAAGCATGGCTACATTGGTGAATTCGAGATCATTGGTGATCACAGAGCTGAGATATCATTGTGAACCTCACAGGAAGGCTGAACAAGTGTGGAATTATCTGCCCTCGATTTGATGTTCAACTCAAAGACCTAGAGAAATGGCAGAACAACCTGCTCCCACCACAGCAGTTTGGTTTCATTGTGCTGACAACCTCGGCTGCCATCATGGACCATGAAGAGACAAGACGAAAACATACAGGAGGGGAAATCCTGGGATTCTTTTTTTAAATGTAAATCATAAATAAAAAGCCTCTGTGGAGTGTGG |
>NM_053982.1 |
ACAGTCACCATGGTGCGAATGAATGTTCTGGCAGATGCTCTCAAGAGCATCAACAACGCGGAGAAGAGGGGCAAACGCCAGGTCCTCATCAGGCCGTGTTCCAAAGTCATCGTTCGGTTCCTAACTGTGATGATGAAGCATGGCTACATTGGTGAATTCGAGATCATTGATGATCACAGAGCTGGGAAGATTGTTGTGAACCTCACAGGAAGGTTGAACAAGTGTGGAGTTATAAGCCCTAGATTTGATGTTCAACTCAAAGACCTAGAGAAGTGGCAGAACAATCTGCTCCCATCACGGCAGTTTGGTTTCATTGTGCTGACGACCTCGGCTGGCATCATGGACCATGAAGAGGCAAGACGAAAACATACAGGAGGGAAAATCCTGGGATTCTTTTTTTAAATGTAAAGCATAAATAAAAAGCCTCTGTGGACTGTG |
PMID - Link | Title |
---|---|
No publications available for this retrocopy |