Retrocopy Name | SnrpeP10 |
![]() |
Species | Rattus norvegicus | |
Coordinates | chr11:14134107-14134429 UCSC | |
Strand | - | |
Parental Sequence | NM_001271237.1 | |
Parental seq. overlap | 279 bp | |
Parental seq. overlap (%) | 66.4% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | SnrpeP10, located on chr11:14134107-14134429, is a retrocopy of the parental gene Snrpe. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | Snrpe |
Full Name | small nuclear ribonucleoprotein polypeptide E |
Also known as | - |
Coordinate | chr13:50252707-50258951 |
Strand | + |
Gene summary | Enables U1 snRNP binding activity. Predicted to be involved in hair cycle and spliceosomal snRNP assembly. Located in nucleus. Part of U1 snRNP. Used to study lupus nephritis. Human ortholog(s) of this gene implicated in hepatocellular carcinoma; hypotrichosis 1; hypotrichosis 11; and lupus nephritis. Orthologous to human SNRPE (small nuclear ribonucleoprotein polypeptide E). [provided by Alliance of Genome Resources, Apr 2022] |
Species | Scientific Name | Retrocopy | |
![]() |
Mouse | Mus musculus | SnrpeP8 |
![]() |
Human | Homo sapiens | Without Homology |
![]() |
Chimpanzee | Pan troglodytes | Without Homology |
![]() |
Bonobo | Pan paniscus | Without Homology |
![]() |
Gorilla | Gorilla gorilla | Without Homology |
![]() |
Orangutan | Pongo abelii | Without Homology |
![]() |
Gibbon | Nomascus leucogenys | Without Homology |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>SnrpeP10 |
GTGACTTCCACCATGGCATATTGTGGCCAGGGCCAGAATGGGCAGAAGGTGATGGTGTAGCCCATCAGCCTCATCTTCAGATACTTGCAAAGTAGATCTTGAATTCAGATGTGGCTGTATTAGCAAATGAATATGTGGATAGAGGACTGTATTATTGGCTTTGATGAGTACAAGAGCCTCATATTAGATGACACAAGAGAGATTCATTCTAAAACAAAGTCAAGAAGAAATCTGGGTCGGAACATGCTAAAAGAAGATAGTATTACTCTGCTCCAGAGTGTCTCCAACTAGAAATGGTCAAACTTGGGAGAAGTTGAAAAGGC |
>NM_001271237.1 |
TTTGTGACTTCCACCATGGCGTACCGCGGCCAGGGCCAGAAGGTGCAGAAGGTGATGGTGCAGCCCATCAACCTTATCTTCAGATACTTGCAAAATAGATCTCGAATTCAGGTGTGGCTGTATGAACAAGTGAATATGCGGATAGAGGGTTGTATTATTGGCTTTGATGAGTACATGAACCTCGTATTAGATGATGCAGAAGAAATTCATTCTAAAACAAAGTCAAGAAAACAACTGGGTCGGATCATGCTCAAAGGAGATAATATTACTCTGCTCCAAAGCGTTTCCAACTAGCAGTGGCCAAGCATGGGAGAGGTTGAGAAGGGGCTCAGGGGCTGCTGGTGACTACATTTACTCATCCTGTTTCACTTGTACATTCTCATTGGGGTAAAAATAAATGTGAGCTTGTTTTTGTTACAA |
PMID - Link | Title |
---|---|
No publications available for this retrocopy |