Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name FAM133BP1
Wait
Plot displaying the genomic locations of a retrocopy (in scaffold_m16_p_2) and its respective parental gene (in scaffold_m16_p_7). Each line represents a retrocopy.
Species Molossus molossus
Coordinates scaffold_m16_p_2:20376859-20377033  UCSC
Strand +
Parental Sequence FAM133B_x5
Parental seq. overlap 153 bp
Parental seq. overlap (%) 46.5%
Genomic Region Intergenic
Retrocopy Summary FAM133BP1, located on scaffold_m16_p_2:20376859-20377033, is a retrocopy of the parental gene FAM133B. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name FAM133B
Full Name N/A
Also known as NULL
Coordinate scaffold_m16_p_7:34419254-34453505
Strand +
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Human Homo sapiens FAM133BP2
Chimpanzee Pan troglodytes FAM133BP5
Bonobo Pan paniscus FAM133BP5
Gorilla Gorilla gorilla FAM133BP6
Orangutan Pongo abelii FAM133BP5
Gibbon Nomascus leucogenys FAM133BP5
Green monkey Chlorocebus sabaeus FAM133BP5
Crab-eating macaque Macaca fascicularis FAM133BP7
Rhesus Macaca mulatta FAM133BP8
Baboon Papio anubis FAM133BP5
Golden snub-nosed monkey Rhinopithecus roxellana FAM133BP2
Mouse lemur Microcebus murinus FAM133BP3
Rabbit Oryctolagus cuniculus FAM133BP4
Pig Sus scrofa FAM133BP1
Cow Bos taurus FAM133BP2
Dolphin Tursiops truncatus FAM133BP1
Horse Equus caballus FAM133BP1
Panda Ailuropoda melanoleuca FAM133BP3
Pale spear-nosed bat Phyllostomus discolor FAM133BP1
Greater mouse-eared bat Myotis myotis FAM133BP1
Greater horseshoe bat Rhinolophus ferrumequinum FAM133BP1
Egyptian rousette Rousettus aegyptiacus FAM133BP1
Marmoset Callithrix jacchus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Sheep Ovis aries Without Homology
Dog Canis familiaris Without Homology
Cat Felis catus Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>FAM133BP1
CCCAACAATACAAGATTATCTGAATCGACCAAGGCCCACCTGGGAAGAAGTGAAGAAAAAAATAGAAAGTAAAAAGAAAGGTTCCAAGGCATTAGCAGAGTTTGAAGAAAAGATGAACGAGAACTGGAAGAAAGAACTAGAACAAAGCAGAGAGAAAGCATTAAGTGGAAATGAG
>FAM133B_x5
ATGGGCAAGAGGGACAACCGGGTGGCCTATATGAACCCAATAGCAATGGCCAGATCAAGGGGTCCAGTCCAGTCTTCGGGGCCAACAATCCAAGATTATCTGAATCGACCAAGGCCTACCTGGGAAGAAGTGAAAGAACAACTAGAAAAGAAAAAGAAGGGTTCCAAGGCATTGGCCGAATTTGAAGAAAAAATGAATGAGAACTGGAAGAAAGAACTTGAAAAGCACAGGGAGAAATTATTAAGTGGAAGTGAGAGCTCGTCTAAAAAAAGACAGAGAAAGAAAAAAGAAAAGAAGAAATCTGGTAGGCAGTTCTTCAGATTCTGA

Publications

PMID - Link Title
No publications available for this retrocopy