Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name RPL23AP24
Plot displaying the genomic locations of a retrocopy (in chr4) and its respective parental gene (in chr16). Each line represents a retrocopy.
Species Macaca mulatta
Coordinates chr4:65318795-65318963  UCSC
Strand -
Parental Sequence NM_001193565.1
Parental seq. overlap 139 bp
Parental seq. overlap (%) 25.6%
Genomic Region Intragenic (SEC63)
Retrocopy Summary RPL23AP24, located on chr4:65318795-65318963, is a retrocopy of the parental gene RPL23A. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL23A
Full Name N/A
Also known as -
Coordinate chr16:24351071-24354730
Strand +
Gene summary N/A

Homology

Species Scientific Name Retrocopy
Human Homo sapiens RPL23AP50
Chimpanzee Pan troglodytes RPL23AP33
Bonobo Pan paniscus RPL23AP35
Gorilla Gorilla gorilla RPL23AP33
Gibbon Nomascus leucogenys RPL23AP11
Crab-eating macaque Macaca fascicularis RPL23AP24
Golden snub-nosed monkey Rhinopithecus roxellana RPL23AP13
Mouse lemur Microcebus murinus RPL23AP16
Dolphin Tursiops truncatus RPL23AP26
Horse Equus caballus RPL23AP12
Cat Felis catus RPL23AP17
Orangutan Pongo abelii Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Baboon Papio anubis Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPL23AP24
ACCAGATCAAACAGGCTGTGAAGAAGCTCTATGACACTGGCATGGCCAAGGTAAACAATACTCAACAGGCCTAATGGAGAGAAGAAGGTGTATGCTCAACTGGCTCCTAACTTATGATGTTTTGAATGCTGCCAACACAATTGAGATGATCTAAAATGAGTCCAGCTGG
>NM_001193565.1
CCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCCGAAGCCAAAGCGAAGGCTTTAAAGGCCAAGAAGGCAGTGTTGAAAGGTGTCCACAGCCACAAAAAAAAGAAGATCCGCACGTCACCCACCTTCCGGCGGCCCAAGACACTGCGACTCCGGAGGCAGCCCAAATATCCTCGGAAGAGCGCCCCCAGGAGAAACAAGCTTGACCACTATGCTATCATCAAGTTTCCGCTGACTACTGAGTCTGCCATGAAGAAGATAGAAGACAACAACACACTTGTGTTCATTGTGGATGTTAAAGCCAACAAGCACCAGATTAAACAGGCTGTGAAGAAGCTCTATGACATTGATGTGGCCAAGGTCAACACCCTGATTCGGCCTGATGGAGAGAAAAAGGCGTATGTTCGACTGGCTCCTGATTACGACGCTTTGGATGTTGCCAACAAAATTGGGATCATCTAAACTGAGTCCAGCTGCCTAATTCtaaatatatatatatatatCTTTTCAACAT

Publications

PMID - Link Title