Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name SELENOKP2
Plot displaying the genomic locations of a retrocopy (in chr4) and its respective parental gene (in chr2). Each line represents a retrocopy.
Species Macaca mulatta
Coordinates chr4:22285279-22285487  UCSC
Strand +
Parental Sequence NM_001159381.2
Parental seq. overlap 186 bp
Parental seq. overlap (%) 26.6%
Genomic Region Intergenic
Retrocopy Summary SELENOKP2, located on chr4:22285279-22285487, is a retrocopy of the parental gene SELENOK. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name SELENOK
Full Name N/A
Also known as SELK
Coordinate chr2:110076408-110083112
Strand -
Gene summary The protein encoded by this gene belongs to the selenoprotein K family. It is a transmembrane protein that is localized in the endoplasmic reticulum (ER), and is involved in ER-associated degradation (ERAD) of misfolded, glycosylated proteins. It also has a role in the protection of cells from ER stress-induced apoptosis. Knockout studies in mice show the importance of this gene in promoting Ca(2+) flux in immune cells and mounting effective immune response. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Multiple pseudogenes of this locus have been identified. [provided by RefSeq, Sep 2017]

Homology

Species Scientific Name Retrocopy
Human Homo sapiens SELENOKP3
Chimpanzee Pan troglodytes SELENOKP1
Bonobo Pan paniscus SELENOKP1
Gorilla Gorilla gorilla SELENOKP1
Orangutan Pongo abelii SELENOKP1
Gibbon Nomascus leucogenys SELENOKP1
Green monkey Chlorocebus sabaeus LOC103227769P6
Baboon Papio anubis SELENOKP3
Golden snub-nosed monkey Rhinopithecus roxellana SELENOKP2
Marmoset Callithrix jacchus SELENOKP2
Crab-eating macaque Macaca fascicularis Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>SELENOKP2
GGATGGCTTACATCTTAAATGGACAAGTGTTGGACAGCAGAGTCTATCTCCGTGGAGATTATCTTAGATAACATATTTCTTCTGAAGAATAGCCAAGTTTGTGATTTTGTTTTTCAAAACTCTGCTTCAGCAACATGTGAAAAAAAGAAGAGGCTATGGAAACACATCTGATTCCAGATATGATAATGGAAGATGACCACCAGGAAACC
>NM_001159381.2
CAGAGGCCGAGAGGGGCCAGGCGCCCGGTCGATCTGAAGCCGGGTAGTGGGAGAAGATGGTTTACATCTCGAACGGACAAGTGTTGGACAGCCGGAGTCAGTCTCCATGGAGATTATCTTTGATAACAGATTTCTTCTGGGGAATAGCTGAGTTTGTGGTTTTGTTTTTCAAAACTCTGCTTCAGCAAGATGTGAAAAAAAGAAGAAGCTATGGAAACTCATCTGATTCCAGATATGATGATGGAAGAGGGCCACCGGGAAACCCTCCCCGAAGAATGGGTAGAATCAATCATCTGCGTGGCCCTAGTCCTCCTCCAATGGCGGGTGGATGAGGAAGGTAAATGTCTGCTCTAAGAAGCAGACAACTGGACATGCACATTCACAGCAGAAGGAAACCATCAAGAAGTGGAAGGCCGACCATGCTGAGCCGTAGATGAATGTGTCTGTCTAAACAAGGACTGCTCTGTGTCCTCACAGATGAATGAGGTCATGCTAGGAATTCCCTCTACAGGGAACTGGCCTGACTGACATGCAGTTCCATAAATGCAGATGTTTGTCTCATGACCTTTTTGTATAGTTTATTAAAGTATTAATATAGTTTTAATAAGTAAATATTTTTAGGTTGCAGAGTGGACTCCTCATCTTTATATTCACGAAAAAACAATCTGAAGAAAATAAATAAAAGCCTGTGTATTTAGCA

Publications

PMID - Link Title