| Retrocopy Name | Rpl9P2 |
|
| Species | Mus musculus | |
| Coordinates | chr1:176166778-176166990 UCSC | |
| Strand | - | |
| Parental Sequence | NM_011292.2 | |
| Parental seq. overlap | 180 bp | |
| Parental seq. overlap (%) | 24.8% | |
| Genomic Region |
Intergenic |
|
| Retrocopy Summary | Rpl9P2, located on chr1:176166778-176166990, is a retrocopy of the parental gene Rpl9. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | Rpl9 |
| Full Name | ribosomal protein L9 |
| Also known as | - |
| Coordinate | chr5:65545707-65548774 |
| Strand | - |
| Gene summary | Predicted to be a structural constituent of ribosome. Predicted to be involved in cytoplasmic translation. Predicted to act upstream of or within translation. Part of cytosolic large ribosomal subunit. Is active in synapse. Orthologous to human RPL9 (ribosomal protein L9). [provided by Alliance of Genome Resources, Apr 2022] |
| Species | Scientific Name | Retrocopy | |
![]() |
Human | Homo sapiens | Without Homology |
![]() |
Chimpanzee | Pan troglodytes | Without Homology |
![]() |
Bonobo | Pan paniscus | Without Homology |
![]() |
Gorilla | Gorilla gorilla | Without Homology |
![]() |
Orangutan | Pongo abelii | Without Homology |
![]() |
Gibbon | Nomascus leucogenys | Without Homology |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >Rpl9P2 |
| GTCTGTGTATGCTCATGTGCCCATCAACATCATTATTCAGGAGAATCAGTCTTGTTGAAAATTGAAATGTCTTGGGTGAAAAATACATCCGCAGGGCTGAGATGAGGGCGGGGATTGCTTGTTCTGTATTTCAAGCCCAGAAAGATGAGTTAATCCTTGAAGTAAATGACATTGAACTCATTCAAATTCAGCTGCTTTCATTCAGCAAGCCAT |
| >NM_011292.2 |
| GGATTACAAGAACGTGATGACGAAAGACGTTCTCTCTTTGCCCCATCTACTGCGAGGATGAAGACCATTCTCAGCAATCAGACTGTGGACATTCCAGAGAATGTCGAAATCACTCTGAAGGGGCGCACAGTCATTGTGAAGGGCCCCAGGGGGACTCTGCGGAGGGACTTCAATCACATCAACGTGGAGCTGAGTCTtcttgggaagaagaagaaaaggCTCCGGGTTGACAAATGGTGGGGTAACAGAAAGGAACTGGCCACCGTCAGGACCATCTGCAGTCATGTTCAGAACATGATCAAGGGTGTCACGCTGGGCTTCCGATACAAGATGCGGTCTGTGTACGCTCACTTCCCCATCAACGTCGTCATCCAGGAGAATGGCTCTTTGGTTGAAATCCGAAATTTCTTGGGTGAAAAATACATCCGCAGGGTTCGGATGAGGACAGGTGTGGCTTGTTCTGTCTCTCAAGCCCAGAAGGATGAGTTAATCCTTGAAGGAAATGACATTGAACTTGTTTCAAATTCAGCTGCCCTGATTCAGCAAGCCACAAcagttaaaaacaaggatatcaggAAGTTTTTGGACGGCATCTATGTGTCTGAGAAGGGAACTGTGCAGCAGGCTGACGAGTGAGGAGGCCTCAGTTCCTGGCCCCAGAAACGAGATCCTGACCACATGAACAATTTGGGCTCTTTTGGGAGAATAAAAGACTTATATATTGA |
| PMID - Link | Title |
|---|